Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14472
Trapped Gene
Yes1 (ENSMUSG00000014932)
Vector Insertion
Chr 5: 32942977 - 32947380
Public Clones FHCRC-GT-S11-3H1 (fhcrc)
Private Clones OST464240 (lexicon) OST411982 (lexicon) OST341078 (lexicon) OST261607 (lexicon)
OST179437 (lexicon) OST174797 (lexicon) OST148720 (lexicon) OST130388 (lexicon)
OST62823 (lexicon) OST62339 (lexicon) OST50227 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185983 (Chr5:32942704..32942976 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185983 (Chr5:32942704..32942976 +)
Downstram Exon
ENSMUSE00000185982 (Chr5:32947381..32947480 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489020 Chr5:32913606..32914210 No primer for this exon
upstream ENSMUSE00000185983 Chr5:32942704..32942976 No primer for this exon

*** Putative Vector Insertion (Chr 5: 32942977 - 32947380) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000185982 Chr5:32947381..32947480 No primer for this exon
downstream ENSMUSE00000185987 Chr5:32954030..32954128 No primer for this exon
downstream ENSMUSE00000185993 Chr5:32955336..32955439 No primer for this exon
downstream ENSMUSE00000481204 Chr5:32955530..32955679 No primer for this exon
downstream ENSMUSE00000548912 Chr5:32957479..32957634 No primer for this exon
downstream ENSMUSE00000548910 Chr5:32957801..32957980 No primer for this exon
downstream ENSMUSE00000247158 Chr5:32961408..32961484 No primer for this exon
downstream ENSMUSE00000185985 Chr5:32963125..32963278 No primer for this exon
downstream ENSMUSE00000506912 Chr5:32966642..32966773 No primer for this exon
downstream ENSMUSE00000508955 Chr5:32986924..32989430 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr5:32946026..32946046 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCATTCTCAGTGGTGTCA Chr5:32945932..32945953 59.25 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014932