Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14476
Trapped Gene
CR956641.9 (ENSMUSG00000083534)
Vector Insertion
Chr 17: 37107785 - 37108342
Public Clones (sanger) D170A08 (ggtc) FHCRC-GT-S11-2E1 (fhcrc) IST10888A11 (tigm)
IST14689B6 (tigm) IST12384G10 (tigm) IST12524B6 (tigm) IST11872H12 (tigm)
Private Clones OST209954 (lexicon) OST207928 (lexicon) OST193699 (lexicon) OST112134 (lexicon)
OST62614 (lexicon) OST39675 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718339 (Chr17:37108263..37108341 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAGACCAAGAACCAGAGC Chr17:37108264..37108283 60.39 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718339 (Chr17:37108263..37108341 -)
Downstram Exon
ENSMUSE00000711268 (Chr17:37107786..37108058 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAGACCAAGAACCAGAGC Chr17:37108264..37108283 60.39 55 TGTCAAAGCGCATAAACTGC Chr17:37107923..37107942 60.02 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718339 Chr17:37108263..37108341 TCCAGACCAAGAACCAGAGC Chr17:37108264..37108283 60.39 55
upstream ENSMUSE00000711268 Chr17:37107786..37108058 GCAGTTTATGCGCTTTGACA Chr17:37107945..37107964 60.02 45

*** Putative Vector Insertion (Chr 17: 37107785 - 37108342) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000717541 Chr17:37107266..37107542 CTCCAAGTGCCTCAGTAGCC Chr17:37107272..37107291 60.01 60
downstream ENSMUSE00000719869 Chr17:37106385..37106666 CTGGTCTCCACAAGGTCCAT Chr17:37106484..37106503 59.96 55
downstream ENSMUSE00000719236 Chr17:37106140..37106262 CCCCAAGGAGAACTACACCA Chr17:37106184..37106203 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGCTCTCAGCATTCCTA Chr17:37108289..37108309 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCACACATCAAGGATGG Chr17:37108336..37108356 59.34 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCTCCGGACAACATAATCG Chr17:37108205..37108225 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAACAGCTCCGGACAACAC Chr17:37108210..37108230 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000083534