Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1448
Trapped Gene
Dapp1 (ENSMUSG00000028159)
Vector Insertion
Chr 3: 137603873 - 137612610
Public Clones CG0110 (sanger) CMHD-GT_465G12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176861 (Chr3:137612611..137612741 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCAGTCCGGGTTCACAC Chr3:137612663..137612682 60.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176861 (Chr3:137612611..137612741 -)
Downstram Exon
ENSMUSE00000176862 (Chr3:137603825..137603872 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCAGTCCGGGTTCACAC Chr3:137612663..137612682 60.37 55 TGGTGAGATAGCCTTCTTTGG Chr3:137603823..137603843 59.32 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635672 Chr3:137644283..137644481 AGGAACTTATGGGCAGAGCA Chr3:137644372..137644391 59.84 50
upstream ENSMUSE00000176860 Chr3:137628845..137628967 TCCAATGGACGTGATGGTAG Chr3:137628899..137628918 59.37 50
upstream ENSMUSE00000176859 Chr3:137624406..137624539 CCTTTGATTGGAAGCGAGAC Chr3:137624408..137624427 59.81 50
upstream ENSMUSE00000176861 Chr3:137612611..137612741 GAATCAGTCCGGGTTCACAC Chr3:137612663..137612682 60.37 55

*** Putative Vector Insertion (Chr 3: 137603873 - 137612610) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176862 Chr3:137603825..137603872 TGGTGAGATAGCCTTCTTTGG Chr3:137603823..137603843 59.32 47.62
downstream ENSMUSE00000176863 Chr3:137602101..137602163 No primer for this exon
downstream ENSMUSE00000176858 Chr3:137600701..137600786 GATCCGAATTGGTTCTGGTG Chr3:137600744..137600763 60.32 50
downstream ENSMUSE00000176856 Chr3:137598546..137598633 ATCCATTCATCGGCTTCAAC Chr3:137598546..137598565 59.9 45
downstream ENSMUSE00000392006 Chr3:137595652..137596153 TTTCCATGGATCAGCAGACA Chr3:137595915..137595934 60.2 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTCGATTTCCCCCAAATG Chr3:137612597..137612617 59.76 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTTGTCAACGTGACTGG Chr3:137606550..137606570 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028159