Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14484
Trapped Gene
Armc6 (ENSMUSG00000002343)
Vector Insertion
Chr 8: 72755178 - 72758366
Public Clones FHCRC-GT-S10-9F1 (fhcrc) IST14557E2 (tigm)
Private Clones OST242040 (lexicon) OST103659 (lexicon) OST53963 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000233624 (Chr8:72758009..72758365 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000233624 (Chr8:72758009..72758365 -)
Downstram Exon
ENSMUSE00000348219 (Chr8:72755179..72755305 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000233624 Chr8:72758009..72758365 No primer for this exon
upstream ENSMUSE00000348219 Chr8:72755179..72755305 No primer for this exon

*** Putative Vector Insertion (Chr 8: 72755178 - 72758366) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000369759 Chr8:72753427..72753509 No primer for this exon
downstream ENSMUSE00000404974 Chr8:72748799..72749372 No primer for this exon
downstream ENSMUSE00000213915 Chr8:72747443..72747588 No primer for this exon
downstream ENSMUSE00000213913 Chr8:72746417..72746548 No primer for this exon
downstream ENSMUSE00000213912 Chr8:72746005..72746142 No primer for this exon
downstream ENSMUSE00000333576 Chr8:72744094..72744776 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTTTTAATCGCCTTGCAG Chr8:72755301..72755321 60.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCCATCTTCGCTCTTTC Chr8:72758329..72758349 62.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTGGGTAATCGCCTTGCAG Chr8:72757943..72757963 62.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTAGACCCGGTGAGGAGCAC Chr8:72757996..72758016 62.04 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002343