Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14486
Trapped Gene
Jmjd1c (ENSMUSG00000037876)
Vector Insertion
Chr 10: 66649060 - 66652483
Public Clones (sanger) P100A06 (ggtc) D045D06 (ggtc) H008D09 (ggtc) D029E02 (ggtc)
P149H07 (ggtc) D098A03 (ggtc) P093A04 (ggtc) D045D06 (ggtc) H003G12 (ggtc)
D009H12 (ggtc) P133F12 (ggtc) D098A03 (ggtc) H008D09 (ggtc) D029E02 (ggtc)
P149H07 (ggtc) H003G12 (ggtc) (ggtc) FHCRC-GT-S17-7C1 (fhcrc) FHCRC-GT-S1-3E1 (fhcrc)
FHCRC-GT-S10-8B1 (fhcrc) IST14681C3 (tigm) IST14424B9 (tigm) IST10491H9 (tigm)
IST15007A1 (tigm) IST14325F1 (tigm) IST14357B5 (tigm) IST10034B4 (tigm)
IST13247A4 (tigm) IST14405A9 (tigm) IST14947G3 (tigm) IST14147D2 (tigm)
IST14207D12 (tigm) IST10846A12 (tigm) IST14338B1 (tigm) IST13303D9 (tigm)
IST10684G12 (tigm)
Private Clones OST389850 (lexicon) OST339145 (lexicon) OST329043 (lexicon) OST290632 (lexicon)
OST290552 (lexicon) OST279229 (lexicon) OST199333 (lexicon) OST185230 (lexicon)
OST55131 (lexicon) OST44822 (lexicon) OST40146 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000419774 (Chr10:66648728..66649059 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTTCGTTCTGTGGTCTTG Chr10:66648813..66648832 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000419774 (Chr10:66648728..66649059 +)
Downstram Exon
ENSMUSE00000642903 (Chr10:66652484..66652597 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTTCGTTCTGTGGTCTTG Chr10:66648813..66648832 60.03 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000419774 Chr10:66648728..66649059 TGCTTCGTTCTGTGGTCTTG Chr10:66648813..66648832 60.03 50

*** Putative Vector Insertion (Chr 10: 66649060 - 66652483) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000642903 Chr10:66652484..66652597 No primer for this exon
downstream ENSMUSE00000642902 Chr10:66678018..66678123 GTCCCTGAGTACGGGCTTTA Chr10:66678056..66678075 59.19 55
downstream ENSMUSE00000642884 Chr10:66679731..66679855 TGGGTGGCAGAATCTTGTCT Chr10:66679791..66679810 60.66 50
downstream ENSMUSE00000289838 Chr10:66680786..66680929 GACCTTCGCCGTGATGTAAT Chr10:66680901..66680920 59.96 50
downstream ENSMUSE00000289832 Chr10:66681025..66681217 GCTGGTCTGGGACTATTTGC Chr10:66681068..66681087 59.7 55
downstream ENSMUSE00000575821 Chr10:66681702..66683383 CTGCCTCGAGTAGGAACTGG Chr10:66682773..66682792 60.01 60
downstream ENSMUSE00000575819 Chr10:66686757..66686929 ATACCATCCGCTGAGGTCAC Chr10:66686815..66686834 59.96 55
downstream ENSMUSE00000371587 Chr10:66687485..66689667 AAGGGTGTAGAGGCCGAAAT Chr10:66688882..66688901 59.96 50
downstream ENSMUSE00000289729 Chr10:66692596..66692797 AAGTCTGCACTCTCGGCACT Chr10:66692732..66692751 60.21 55
downstream ENSMUSE00000289722 Chr10:66694720..66694934 CAACGCTGTTTTCTCAGACG Chr10:66694918..66694937 59.63 50
downstream ENSMUSE00000289712 Chr10:66696119..66696271 GTGGACGTTGAACAGTGTGG Chr10:66696201..66696220 60.05 55
downstream ENSMUSE00000289707 Chr10:66700856..66700945 GCTGGCCTTTCACACACTTC Chr10:66700900..66700919 60.84 55
downstream ENSMUSE00000289699 Chr10:66701555..66701682 AAGAATGTGCATGGCATCAA Chr10:66701592..66701611 60.08 40
downstream ENSMUSE00000289693 Chr10:66701997..66702207 CTTGCACTTCCAGGGCTACT Chr10:66702118..66702137 59.5 55
downstream ENSMUSE00000666227 Chr10:66701997..66702177 CTTGCACTTCCAGGGCTACT Chr10:66702118..66702137 59.5 55
downstream ENSMUSE00000575817 Chr10:66702610..66702824 TGGTCAGCAAATCACGTAGG Chr10:66702750..66702769 59.72 50
downstream ENSMUSE00000289677 Chr10:66703411..66703689 TGCTGGTCACAGATCCAAGA Chr10:66703619..66703638 60.4 50
downstream ENSMUSE00000289672 Chr10:66706520..66706688 CTCCTTAACGTTGGCATTGG Chr10:66706663..66706682 60.49 50
downstream ENSMUSE00000289662 Chr10:66707531..66707621 CTTGAAGTCCTCCCCAGATG Chr10:66707607..66707626 59.65 55
downstream ENSMUSE00000289657 Chr10:66708254..66708384 ACAAAGAACCCTGGCAAATG Chr10:66708349..66708368 59.97 45
downstream ENSMUSE00000666226 Chr10:66708361..66708384 No primer for this exon
downstream ENSMUSE00000289650 Chr10:66708782..66708904 AGAGGACGCCATTTCCTTTT Chr10:66708898..66708917 60.07 45
downstream ENSMUSE00000289640 Chr10:66710759..66710898 CACCAGGGATTTCACTCGAA Chr10:66710842..66710861 61.03 50
downstream ENSMUSE00000289631 Chr10:66712378..66712554 GTCTCTGGCGGAGCTTTCTA Chr10:66712471..66712490 59.72 55
downstream ENSMUSE00000612311 Chr10:66717200..66717331 TCTTCGGTCACCTGAACACA Chr10:66717240..66717259 60.28 50
downstream ENSMUSE00000642890 Chr10:66718196..66719066 CCAACCGCAATTAGGTGTCT Chr10:66718298..66718317 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTTTTAATCGCCTTGCAG Chr10:66652105..66652125 61.12 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGACTGCTCTTCCTCACT Chr10:66652015..66652035 60.79 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037876