Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14487
Trapped Gene
Rai16 (ENSMUSG00000022095)
Vector Insertion
Chr 14: 70993775 - 70999644
Public Clones D178H08 (ggtc) D178H08 (ggtc) FHCRC-GT-S10-7C1 (fhcrc)
Private Clones OST446828 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000496067 (Chr14:70999549..70999643 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000496067 (Chr14:70999549..70999643 -)
Downstram Exon
ENSMUSE00000407806 (Chr14:70993776..70993854 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATGCCTTTCCAATGTTCCAC Chr14:70993780..70993799 59.8 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496067 Chr14:70999549..70999643 No primer for this exon
upstream ENSMUSE00000407806 Chr14:70993776..70993854 CATTGGAAAGGCATCACACA Chr14:70993796..70993815 60.52 45

*** Putative Vector Insertion (Chr 14: 70993775 - 70999644) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000363026 Chr14:70991382..70991554 AGAGTGCACAGGGTCTCCAG Chr14:70991373..70991392 60.46 60
downstream ENSMUSE00000401029 Chr14:70990147..70990251 CTCAGGTAGTGCAGCAGTGG Chr14:70990144..70990163 59.64 60
downstream ENSMUSE00000349128 Chr14:70989936..70990058 CCCTCCAAGTCGGAGAAGTT Chr14:70990016..70990035 60.62 55
downstream ENSMUSE00000392115 Chr14:70988683..70988928 GTCCAGGATCCCTGTTGAGA Chr14:70988786..70988805 60.05 55
downstream ENSMUSE00000555983 Chr14:70988410..70988606 CAGCTATCGCCATACAGCAG Chr14:70988470..70988489 59.61 55
downstream ENSMUSE00000613842 Chr14:70988069..70988177 GTCTCATCAGATGGGGCACT Chr14:70988129..70988148 60.08 55
downstream ENSMUSE00000613841 Chr14:70987769..70987845 CAAACAGCTTCTCAGCCACA Chr14:70987778..70987797 60.17 50
downstream ENSMUSE00000613840 Chr14:70987358..70987547 TATGGGGGCTGTCCTCTATG Chr14:70987383..70987402 59.91 55
downstream ENSMUSE00000647533 Chr14:70986613..70986758 GCTCCTCAAATAGCCTCAGC Chr14:70986703..70986722 59.18 55
downstream ENSMUSE00000613829 Chr14:70986377..70986505 GGAAGCCATCGGTGAAGTAG Chr14:70986446..70986465 59.69 55
downstream ENSMUSE00000613828 Chr14:70986164..70986254 AAGGCTGATGTCTTGGCTTC Chr14:70986191..70986210 59.43 50
downstream ENSMUSE00000706448 Chr14:70986164..70986505 TCTCCGTCACTGCTGTTTTG Chr14:70986365..70986384 60.03 50
downstream ENSMUSE00000613827 Chr14:70985882..70986025 TCAGGCTCATGAGAGTCCAA Chr14:70985927..70985946 59.5 50
downstream ENSMUSE00000706447 Chr14:70985882..70986025 TCAGGCTCATGAGAGTCCAA Chr14:70985927..70985946 59.5 50
downstream ENSMUSE00000400572 Chr14:70985426..70985566 AGGCTGATGTAGGGATCCAG Chr14:70985444..70985463 59.12 55
downstream ENSMUSE00000706446 Chr14:70985426..70985566 AGGCTGATGTAGGGATCCAG Chr14:70985444..70985463 59.12 55
downstream ENSMUSE00000706445 Chr14:70985184..70985246 No primer for this exon
downstream ENSMUSE00000123523 Chr14:70985146..70985246 AGTTGCTTGCGTACCAGGAG Chr14:70985148..70985167 60.45 55
downstream ENSMUSE00000555985 Chr14:70984852..70984990 AGACTTGCCCTTCTGGAGGT Chr14:70984832..70984851 60.25 55
downstream ENSMUSE00000647529 Chr14:70983103..70983806 TTGAGTATTGCCCAGCCTCT Chr14:70983144..70983163 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGACATAATCGCCTTGCAG Chr14:70996579..70996599 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCACCTAAACGTCTTCCT Chr14:70996628..70996648 60.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GACTTCTTGACCTGGCCTTG Chr14:70996514..70996534 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GACTTCTTGACCTGGCCTTG Chr14:70996514..70996534 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022095