Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1449
Trapped Gene
Numa1 (ENSMUSG00000066306)
Vector Insertion
Chr 7: 109162456 - 109162749
Public Clones CF0436 (sanger)
Private Clones OST116175 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000528729 (Chr7:109162252..109162455 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTACTGTTGCCACCACTC Chr7:109162419..109162438 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000528729 (Chr7:109162252..109162455 +)
Downstram Exon
ENSMUSE00000671673 (Chr7:109162750..109163472 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTACTGTTGCCACCACTC Chr7:109162419..109162438 59.9 55 ACCCCTGAGATCCAGAACCT Chr7:109163321..109163340 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000671692 Chr7:109118357..109118483 GCAGCTATCGGGACAGAAGA Chr7:109118358..109118377 60.5 55
upstream ENSMUSE00000528838 Chr7:109125894..109125964 CAGCTACGCTCCTTTCTTGG Chr7:109125945..109125964 60.15 55
upstream ENSMUSE00000633252 Chr7:109136240..109136325 CAGGACTGCAGCATCTTCAT Chr7:109136288..109136307 58.99 50
upstream ENSMUSE00000633251 Chr7:109139087..109139166 GAGGGGCAACAAATCCTACA Chr7:109139100..109139119 59.93 50
upstream ENSMUSE00000633250 Chr7:109140160..109140242 TAGAGGGATCCGAGATGGAA Chr7:109140214..109140233 59.58 50
upstream ENSMUSE00000633247 Chr7:109141152..109141232 CCATGAGCTCCAGAAACCTC Chr7:109141180..109141199 59.8 55
upstream ENSMUSE00000633245 Chr7:109141739..109141826 GCTGAGTTAGCGGTCATCCT Chr7:109141739..109141758 59.46 55
upstream ENSMUSE00000633244 Chr7:109143177..109143294 CCAAGAGGAAGATTCGCTTC Chr7:109143234..109143253 59.01 50
upstream ENSMUSE00000633242 Chr7:109143911..109144068 CAGACCCCACAGTTCCAGAT Chr7:109143954..109143973 59.96 55
upstream ENSMUSE00000633241 Chr7:109144332..109144449 CTCCGAGGCAAGAATGAAAG Chr7:109144430..109144449 59.95 50
upstream ENSMUSE00000633240 Chr7:109144537..109144654 GAGCCAGATGGATCGAAAGA Chr7:109144594..109144613 60.3 50
upstream ENSMUSE00000633239 Chr7:109144949..109145089 CAACTTCAGGGTGCATTCAA Chr7:109144976..109144995 59.69 45
upstream ENSMUSE00000633238 Chr7:109146589..109146711 TTCCCAGCTGGAAGATCAAG Chr7:109146630..109146649 60.33 50
upstream ENSMUSE00000528763 Chr7:109146814..109150173 GAAATGCGACAAGAAGCACA Chr7:109150042..109150061 59.99 45
upstream ENSMUSE00000528759 Chr7:109156000..109156068 AGCTGACAGAGCATGACCAA Chr7:109156019..109156038 59.58 50
upstream ENSMUSE00000528756 Chr7:109157605..109157724 GTGAAAGCCAGCAAGAGGTC Chr7:109157624..109157643 60 55
upstream ENSMUSE00000528753 Chr7:109157808..109158026 GAACCAAAAGCTGCAGGAAC Chr7:109157849..109157868 59.86 50
upstream ENSMUSE00000528751 Chr7:109158131..109158288 GATGCCTTAAAGAGCCGTGA Chr7:109158185..109158204 60.35 50
upstream ENSMUSE00000528748 Chr7:109159347..109159593 GCCTCTACTTCACCCCCACT Chr7:109159445..109159464 60.51 60
upstream ENSMUSE00000528744 Chr7:109160395..109160623 CTACAGCACGCAGTCTGCTC Chr7:109160436..109160455 59.95 60
upstream ENSMUSE00000528740 Chr7:109161256..109161392 AGCAGCTGGATGATTGGAAC Chr7:109161298..109161317 60.23 50
upstream ENSMUSE00000528736 Chr7:109161683..109161859 CAGGGAAACCTTGCGTAGAG Chr7:109161736..109161755 59.87 55
upstream ENSMUSE00000528733 Chr7:109162044..109162160 TGAAGGACGTAAGCAGAGCA Chr7:109162097..109162116 59.74 50
upstream ENSMUSE00000528729 Chr7:109162252..109162455 TGCTACTGTTGCCACCACTC Chr7:109162419..109162438 59.9 55

*** Putative Vector Insertion (Chr 7: 109162456 - 109162749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000671673 Chr7:109162750..109163472 ACCCCTGAGATCCAGAACCT Chr7:109163321..109163340 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCAAGGTAACGCAGTAGA Chr7:109162450..109162470 60.27 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCAAGGTAACGCAGTAGA Chr7:109162450..109162470 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066306