Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1451
Trapped Gene
Zfp609 (ENSMUSG00000040524)
Vector Insertion
Chr 9: 65579009 - 65642428
Public Clones CD0574 (sanger) (sanger) (sanger) RRJ186 (baygenomics) XK115 (baygenomics)
(ggtc) IST14981H8 (tigm) IST14683G12 (tigm)
Private Clones OST90445 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000421911 (Chr9:65642429..65643134 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTCATCATCGACCTGGAC Chr9:65643059..65643078 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000421911 (Chr9:65642429..65643134 -)
Downstram Exon
ENSMUSE00000421905 (Chr9:65578783..65579008 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTCATCATCGACCTGGAC Chr9:65643059..65643078 59.93 55 TGACACCAACTGATCGGGTA Chr9:65578866..65578885 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000421911 Chr9:65642429..65643134 ACCTCATCATCGACCTGGAC Chr9:65643059..65643078 59.93 55
upstream ENSMUSE00000696965 Chr9:65642429..65643175 ACCTCATCATCGACCTGGAC Chr9:65643059..65643078 59.93 55

*** Putative Vector Insertion (Chr 9: 65579009 - 65642428) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000421905 Chr9:65578783..65579008 TGACACCAACTGATCGGGTA Chr9:65578866..65578885 59.96 50
downstream ENSMUSE00000347915 Chr9:65553898..65553985 CAATCATGCCTTGTGCAGTC Chr9:65553888..65553907 60.27 50
downstream ENSMUSE00000388050 Chr9:65550079..65552425 GGCACGTAGGCATACTGGTT Chr9:65550526..65550545 60.02 55
downstream ENSMUSE00000246135 Chr9:65548629..65548995 TCTTTCCACCGATCATCCTC Chr9:65548894..65548913 60.01 50
downstream ENSMUSE00000246119 Chr9:65545301..65545476 GCCATACGGGGAGAAAGAAT Chr9:65545414..65545433 60.29 50
downstream ENSMUSE00000411360 Chr9:65544839..65545055 GCGGCATAGGGTAGGTTGTA Chr9:65544819..65544838 59.98 55
downstream ENSMUSE00000352537 Chr9:65543950..65544028 AGTGAGGGAGTTGAGCCTTG Chr9:65543955..65543974 59.45 55
downstream ENSMUSE00000584165 Chr9:65543269..65543501 TGACTTCATCTGGGCACTTG Chr9:65543455..65543474 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCCCCAGACCTCATATTT Chr9:65615429..65615449 59.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAACGTGACTGGGAAAACC Chr9:65615361..65615381 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAATCCAAGAAAAGGTGCT Chr9:65604124..65604144 58.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTTCGTGACTGGGAAAACC Chr9:65616068..65616088 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040524