Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14534
Trapped Gene
Taok1 (ENSMUSG00000017291)
Vector Insertion
Chr 11: 77393275 - 77398997
Public Clones FHCRC-GT-S7-2D1 (fhcrc) IST14539H8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000394425 (Chr11:77398775..77398996 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000394425 (Chr11:77398775..77398996 -)
Downstram Exon
ENSMUSE00000517588 (Chr11:77393276..77393347 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676578 Chr11:77420710..77421317 No primer for this exon
upstream ENSMUSE00000394425 Chr11:77398775..77398996 No primer for this exon
upstream ENSMUSE00000650377 Chr11:77398775..77399008 No primer for this exon
upstream ENSMUSE00000517588 Chr11:77393276..77393347 No primer for this exon

*** Putative Vector Insertion (Chr 11: 77393275 - 77398997) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000436598 Chr11:77392228..77392329 No primer for this exon
downstream ENSMUSE00000399218 Chr11:77390825..77390870 No primer for this exon
downstream ENSMUSE00000520605 Chr11:77389075..77389171 No primer for this exon
downstream ENSMUSE00000390961 Chr11:77387198..77387311 No primer for this exon
downstream ENSMUSE00000650385 Chr11:77385109..77385200 No primer for this exon
downstream ENSMUSE00000292300 Chr11:77379248..77379341 No primer for this exon
downstream ENSMUSE00000506921 Chr11:77377166..77377247 No primer for this exon
downstream ENSMUSE00000292285 Chr11:77373756..77373923 No primer for this exon
downstream ENSMUSE00000292280 Chr11:77373244..77373447 No primer for this exon
downstream ENSMUSE00000292368 Chr11:77369066..77369200 No primer for this exon
downstream ENSMUSE00000292362 Chr11:77367175..77367411 No primer for this exon
downstream ENSMUSE00000110251 Chr11:77364374..77364502 No primer for this exon
downstream ENSMUSE00000110249 Chr11:77362774..77362977 No primer for this exon
downstream ENSMUSE00000110248 Chr11:77358791..77359030 No primer for this exon
downstream ENSMUSE00000292331 Chr11:77355127..77355339 No primer for this exon
downstream ENSMUSE00000110253 Chr11:77353556..77353738 No primer for this exon
downstream ENSMUSE00000401736 Chr11:77342664..77351830 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr11:77398928..77398948 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCGTGGCTTCATTCATAC Chr11:77395968..77395988 59.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017291