Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14535
Trapped Gene
Cadm1 (ENSMUSG00000032076)
Vector Insertion
Chr 9: 47338589 - 47596049
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
E324F02 (ggtc) D075F03 (ggtc) D188D12 (ggtc) (ggtc) D075G04 (ggtc)
FHCRC-GT-S7-2C1 (fhcrc) IST10078B6 (tigm) IST11122C8 (tigm) IST14481A6 (tigm)
IST14500E5 (tigm) IST14086E6 (tigm) IST11484G11 (tigm) IST14481A6 (tigm)
IST10068C10 (tigm) IST10836B6 (tigm) IST10604D11 (tigm) IST13490C3 (tigm)
IST12933A7 (tigm) IST12838A6 (tigm) IST12887E5 (tigm) IST13891B12 (tigm)
IST13740G6 (tigm) IST11899E3 (tigm) IST14699G6 (tigm) IST11029G1 (tigm)
IST13705A7 (tigm) IST10224A1 (tigm) IST12379E1 (tigm) IST11343C2 (tigm)
IST13692A6 (tigm) IST11151B8 (tigm) IST13791B1 (tigm) IST10685E11 (tigm)
IST10836C6 (tigm) IST11248E11 (tigm) IST11732E12 (tigm) IST13899D2 (tigm)
IST11945H7 (tigm) IST10685E11 (tigm) IST11029G1 (tigm) IST11317C1 (tigm)
IST11761H2 (tigm) IST12265E12 (tigm) IST14086E6 (tigm) IST10836B6 (tigm)
IST12738E6 (tigm) IST11263A1 (tigm) IST12265E12 (tigm) IST12758G11 (tigm)
IST11627C12 (tigm) IST10515D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699728 (Chr9:47338256..47338588 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699728 (Chr9:47338256..47338588 +)
Downstram Exon
ENSMUSE00000699702 (Chr9:47596050..47596200 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50 GCTGGATCACTGAGTCGTCA Chr9:47596158..47596177 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699728 Chr9:47338256..47338588 CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50
upstream ENSMUSE00000699721 Chr9:47338340..47338588 CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50
upstream ENSMUSE00000699740 Chr9:47338340..47338588 CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50
upstream ENSMUSE00000468394 Chr9:47338456..47338588 CTCCTGCTGTTGCTCCTTTC Chr9:47338546..47338565 60.13 55

*** Putative Vector Insertion (Chr 9: 47338589 - 47596049) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699702 Chr9:47596050..47596200 GCTGGATCACTGAGTCGTCA Chr9:47596158..47596177 59.99 55
downstream ENSMUSE00000362801 Chr9:47596054..47596200 GCTGGATCACTGAGTCGTCA Chr9:47596158..47596177 59.99 55
downstream ENSMUSE00000535523 Chr9:47597780..47597932 TCTCCCTTCATCCGAGATTG Chr9:47597874..47597893 60.15 50
downstream ENSMUSE00000535518 Chr9:47605490..47605627 ACTGCCGTGTCTTTCTGGAT Chr9:47605538..47605557 59.73 50
downstream ENSMUSE00000467679 Chr9:47607455..47607613 CTAGATAGCGCTGGGTCTGC Chr9:47607607..47607626 60.14 60
downstream ENSMUSE00000473772 Chr9:47618127..47618226 GCCTTGCAGAGGGTAAGTCA Chr9:47618173..47618192 60.4 55
downstream ENSMUSE00000461284 Chr9:47621856..47622028 TAGTCCGAATGAGCCTTTCC Chr9:47622014..47622033 59.27 50
downstream ENSMUSE00000216272 Chr9:47626817..47626900 TGGGAGGAGGGATAGTTGTG Chr9:47626846..47626865 59.92 55
downstream ENSMUSE00000216271 Chr9:47637460..47637492 CGTGAACTGCTGGTTCTGTC Chr9:47637495..47637514 59.47 55
downstream ENSMUSE00000216275 Chr9:47656250..47656381 AAATAGCGGCCCAGAATGAT Chr9:47656370..47656389 60.79 45
downstream ENSMUSE00000488995 Chr9:47658355..47658473 ATAGCTGTGTCTGCGTCTGC Chr9:47658418..47658437 59.22 55
downstream ENSMUSE00000699718 Chr9:47658355..47659112 AGAAACTGGCAACAGGGAGA Chr9:47658977..47658996 59.84 50
downstream ENSMUSE00000699720 Chr9:47658355..47661463 AAACCCTTTCAACGACATGC Chr9:47660719..47660738 59.98 45
downstream ENSMUSE00000699727 Chr9:47658355..47661468 AAACCCTTTCAACGACATGC Chr9:47660719..47660738 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAAAGGCGCCTCCTCTCAG Chr9:47491593..47491613 60.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTAGGCGTGACTGGGAAA Chr9:47491633..47491653 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032076