Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1454
Trapped Gene
Hip2 (ENSMUSG00000029203)
Vector Insertion
Chr 5: 65972708 - 65983114
Public Clones (sanger) CD0525 (sanger) IST13938C2 (tigm) IST12641B6 (tigm)
Private Clones OST415725 (lexicon) OST246341 (lexicon) OST217776 (lexicon) OST162715 (lexicon)
OST112419 (lexicon) OST37289 (lexicon) OST14564 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254349 (Chr5:65972625..65972707 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCACAGGGGCTATTTGTT Chr5:65972666..65972685 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254349 (Chr5:65972625..65972707 +)
Downstram Exon
ENSMUSE00000186857 (Chr5:65983115..65983214 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCACAGGGGCTATTTGTT Chr5:65972666..65972685 59.99 50 ACAATAATACCGTGCGCAGA Chr5:65983152..65983171 59.21 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716543 Chr5:65928539..65928785 CGCGGAGGTGATTCTACAGT Chr5:65928545..65928564 60.28 55
upstream ENSMUSE00000254377 Chr5:65928570..65928785 GAATCAAGCGGGAGTTCAAG Chr5:65928745..65928764 59.81 50
upstream ENSMUSE00000254368 Chr5:65957228..65957321 CCTCCAGACACACCGTATGA Chr5:65957300..65957319 59.54 55
upstream ENSMUSE00000254358 Chr5:65962771..65962829 No primer for this exon
upstream ENSMUSE00000254349 Chr5:65972625..65972707 CGTCACAGGGGCTATTTGTT Chr5:65972666..65972685 59.99 50

*** Putative Vector Insertion (Chr 5: 65972708 - 65983114) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186857 Chr5:65983115..65983214 ACAATAATACCGTGCGCAGA Chr5:65983152..65983171 59.21 45
downstream ENSMUSE00000186858 Chr5:65985659..65985787 GTACACGTGTGCCCAAAGTC Chr5:65985718..65985737 59.06 55
downstream ENSMUSE00000254330 Chr5:65986114..65986379 CAGCTCCTGTGCCTCAGTTA Chr5:65986204..65986223 59.19 55
downstream ENSMUSE00000710549 Chr5:65986114..65987632 TGAGAATCTCCGCTCTGGAT Chr5:65986775..65986794 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:65981758..65981778 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTTTTATTTCCCCGTGAC Chr5:65981744..65981765 60.17 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029203