Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14543
Trapped Gene
Mcoln1 (ENSMUSG00000004567)
Vector Insertion
Chr 8: 3500628 - 3505737
Public Clones FHCRC-GT-S6-9B1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611177 (Chr8:3500508..3500627 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611177 (Chr8:3500508..3500627 +)
Downstram Exon
ENSMUSE00000611176 (Chr8:3505738..3505943 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611177 Chr8:3500508..3500627 No primer for this exon

*** Putative Vector Insertion (Chr 8: 3500628 - 3505737) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000611176 Chr8:3505738..3505943 No primer for this exon
downstream ENSMUSE00000611175 Chr8:3507149..3507316 No primer for this exon
downstream ENSMUSE00000611174 Chr8:3507401..3507566 No primer for this exon
downstream ENSMUSE00000233202 Chr8:3508319..3508427 No primer for this exon
downstream ENSMUSE00000233194 Chr8:3508684..3508780 No primer for this exon
downstream ENSMUSE00000233186 Chr8:3509136..3509235 No primer for this exon
downstream ENSMUSE00000209941 Chr8:3510320..3510426 No primer for this exon
downstream ENSMUSE00000209939 Chr8:3510540..3510689 No primer for this exon
downstream ENSMUSE00000209940 Chr8:3510814..3510915 No primer for this exon
downstream ENSMUSE00000233158 Chr8:3511688..3511810 No primer for this exon
downstream ENSMUSE00000209934 Chr8:3512650..3512865 No primer for this exon
downstream ENSMUSE00000686599 Chr8:3513301..3513561 No primer for this exon
downstream ENSMUSE00000209926 Chr8:3514783..3514913 No primer for this exon
downstream ENSMUSE00000573421 Chr8:3515014..3515229 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAACAACAAAGACCATCCTTT Chr8:3503584..3503606 58.6 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACAACAAAGACCATCCTTT Chr8:3503584..3503606 58.6 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004567