Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1455
Trapped Gene
AC145736.4-202 (ENSMUSG00000054574)
Vector Insertion
Chr 9: 104149171 - 104165028
Public Clones CD0500 (sanger) (sanger) (sanger) RRT694 (baygenomics) XL239 (baygenomics)
E022B09 (ggtc) (ggtc) E022B09 (ggtc) IST14718H2 (tigm)
Private Clones OST368893 (lexicon) OST298217 (lexicon) OST246501 (lexicon) OST237783 (lexicon)
OST171559 (lexicon) OST57220 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634687 (Chr9:104165029..104165264 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCCTCCATCCTACTCAAGA Chr9:104165085..104165104 60.35 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634687 (Chr9:104165029..104165264 -)
Downstram Exon
ENSMUSE00000390659 (Chr9:104149090..104149170 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCCTCCATCCTACTCAAGA Chr9:104165085..104165104 60.35 55 CCATGAGTGCTTGGTTGTGT Chr9:104149076..104149095 59.6 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634687 Chr9:104165029..104165264 CGCCTCCATCCTACTCAAGA Chr9:104165085..104165104 60.35 55

*** Putative Vector Insertion (Chr 9: 104149171 - 104165028) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390659 Chr9:104149090..104149170 CCATGAGTGCTTGGTTGTGT Chr9:104149076..104149095 59.6 50
downstream ENSMUSE00000395222 Chr9:104140795..104140870 GCATGGGTTCCAACTGAAAA Chr9:104140816..104140835 60.87 45
downstream ENSMUSE00000359798 Chr9:104139907..104140056 CAACAGGGCTGATGCTACAA Chr9:104139998..104140017 59.86 50
downstream ENSMUSE00000342289 Chr9:104139466..104139507 TGTGATTTTTCCCTCTGCAA Chr9:104139450..104139469 59.25 40
downstream ENSMUSE00000396990 Chr9:104135864..104136064 GCCTCCAGGAGTTACTTCCA Chr9:104135971..104135990 59.28 55
downstream ENSMUSE00000382345 Chr9:104133161..104133367 TGTAGTTGCCAGCGTGTTCT Chr9:104133279..104133298 59.51 50
downstream ENSMUSE00000337353 Chr9:104132971..104133066 TGACCGCCAGAACTCTTTTC Chr9:104133017..104133036 60.38 50
downstream ENSMUSE00000364491 Chr9:104132340..104132431 TTTCCGAACTTGCCCTTTTA Chr9:104132335..104132354 59.69 40
downstream ENSMUSE00000338430 Chr9:104131205..104131371 TCGGTGCCATCTTAACACAA Chr9:104131273..104131292 60.11 45
downstream ENSMUSE00000356888 Chr9:104131011..104131090 ATGCAGCACTCCACTGTAGG Chr9:104131004..104131023 58.91 55
downstream ENSMUSE00000404720 Chr9:104130753..104130922 AGGCTACAACATCCCCCTCT Chr9:104130819..104130838 59.96 55
downstream ENSMUSE00000379751 Chr9:104123734..104123833 CATGGATGACTCCGTTGTTG Chr9:104123744..104123763 59.96 50
downstream ENSMUSE00000408274 Chr9:104122201..104122308 No primer for this exon
downstream ENSMUSE00000383100 Chr9:104120857..104121012 AACTGCTGCCCTTCAGTTGT Chr9:104120893..104120912 59.91 50
downstream ENSMUSE00000348139 Chr9:104120042..104120098 TAACCAATCCAGCTCCCTTC Chr9:104120037..104120056 59.13 50
downstream ENSMUSE00000385934 Chr9:104117976..104118097 GTAAGCATGCGCTGATCTGA Chr9:104117960..104117979 60.13 50
downstream ENSMUSE00000412641 Chr9:104116453..104116528 TGTGTTATCAGCGGTCCAGA Chr9:104116461..104116480 60.26 50
downstream ENSMUSE00000367061 Chr9:104116147..104116242 CTTCTCCGGAACTGGATCTG Chr9:104116170..104116189 59.8 55
downstream ENSMUSE00000342773 Chr9:104115091..104115234 TCCTATCCCTCCAGTGCATC Chr9:104115089..104115108 60.03 55
downstream ENSMUSE00000692361 Chr9:104111635..104111717 TCGAAGAACTACTGGCTTTTGA Chr9:104111666..104111687 59.15 40.91
downstream ENSMUSE00000692360 Chr9:104110083..104110236 TCGATCTAGCGTGGTCTTGA Chr9:104110189..104110208 59.55 50
downstream ENSMUSE00000692359 Chr9:104105745..104105848 TCTGCCAGGCACTCATATTT Chr9:104105804..104105823 58.33 45
downstream ENSMUSE00000692358 Chr9:104105502..104105661 GAGCAGGAAGCGATGGTAGA Chr9:104105600..104105619 60.5 55
downstream ENSMUSE00000692356 Chr9:104104218..104104280 TCCCGCTCGAGTTTATCAGT Chr9:104104236..104104255 59.84 50
downstream ENSMUSE00000692354 Chr9:104102767..104102867 TCTAATGCCGTTTGAGTCCA Chr9:104102808..104102827 59.27 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACCCACGACCTGTAATCG Chr9:104158971..104158991 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGATTTCAGCCAAAACACCA Chr9:104159044..104159065 60.1 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AACGCTCTGCCTTTACCTGT Chr9:104159227..104159247 59.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACGCTCTGCCTTTACCTGT Chr9:104159227..104159247 59.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054574