Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14552
Trapped Gene
2900011O08Rik (ENSMUSG00000044117)
Vector Insertion
Chr 16: 13986987 - 14049475
Public Clones (sanger) (ggtc) CMHD-GT_474F8-3 (cmhd) (cmhd) FHCRC-GT-S6-5D1 (fhcrc)
IST12174H2HMR1 (tigm) IST12174A11 (tigm) IST15102B3 (tigm) IST12125G1 (tigm)
IST10704C10 (tigm) IST14751H9 (tigm) IST12173D12HMR1 (tigm) IST12172H11 (tigm)
IST12553A11 (tigm) IST14968E1 (tigm) IST12286A12 (tigm) IST13608C3 (tigm)
IST12174H9 (tigm) IST10132B1 (tigm) IST10386C6 (tigm) IST11215H12 (tigm)
IST12125H1 (tigm) IST12173F12HMR1 (tigm) IST12174G12 (tigm) IST12174A11 (tigm)
IST13012E3 (tigm) IST14912A9 (tigm) IST12171B7 (tigm) IST12176A6 (tigm)
IST11047G5 (tigm) IST15086C6 (tigm) IST12175B1 (tigm) IST12538B12 (tigm)
IST12175G2HMR1 (tigm) IST14858D9 (tigm) IST12173F8 (tigm) IST12323F7 (tigm)
IST14793C11 (tigm) IST10922E1 (tigm) IST12176H4HMR1 (tigm) IST10353E1 (tigm)
IST13066F12 (tigm) IST12171C12 (tigm) IST10937E8 (tigm) IST15086C6 (tigm)
IST11464C12 (tigm) IST14727G5 (tigm) IST12841A1 (tigm) IST10704C10 (tigm)
IST12172H11 (tigm)
Private Clones OST111025 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000378060 (Chr16:13986721..13986986 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCCTCTCAGGCGTTATG Chr16:13986925..13986944 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000378060 (Chr16:13986721..13986986 +)
Downstram Exon
ENSMUSE00000358544 (Chr16:14049476..14049599 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCCTCTCAGGCGTTATG Chr16:13986925..13986944 59.98 55 CTGGTCTCAGCCATGGAGAT Chr16:14049512..14049531 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000378060 Chr16:13986721..13986986 GAAGCCTCTCAGGCGTTATG Chr16:13986925..13986944 59.98 55
upstream ENSMUSE00000717969 Chr16:13986750..13986986 GAAGCCTCTCAGGCGTTATG Chr16:13986925..13986944 59.98 55

*** Putative Vector Insertion (Chr 16: 13986987 - 14049475) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358544 Chr16:14049476..14049599 CTGGTCTCAGCCATGGAGAT Chr16:14049512..14049531 60.22 55
downstream ENSMUSE00000399792 Chr16:14089039..14089112 TGCTTCAGGTCCATGATGTC Chr16:14089086..14089105 59.64 50
downstream ENSMUSE00000358904 Chr16:14093982..14094096 GCATCATCCACCAGGAAGTC Chr16:14094081..14094100 60.48 55
downstream ENSMUSE00000414187 Chr16:14095997..14096079 GGAAATCAGCCATTTCCTTG Chr16:14096034..14096053 59.51 45
downstream ENSMUSE00000715476 Chr16:14095997..14096079 GGAAATCAGCCATTTCCTTG Chr16:14096034..14096053 59.51 45
downstream ENSMUSE00000392859 Chr16:14099886..14101593 CTCTGCTACCTGGTCCAAGC Chr16:14100726..14100745 60.01 60
downstream ENSMUSE00000720192 Chr16:14099886..14100321 TGTTTTAAGGGAGGGGCTTT Chr16:14100283..14100302 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTTGCCTCTGAGGTACTGA Chr16:14010971..14010992 59.25 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTTGCCTCTGAGGTACTGA Chr16:14010971..14010992 59.25 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044117