Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14563
Trapped Gene
Vpreb3 (ENSMUSG00000000903)
Vector Insertion
Chr 10: 75411155 - 75411887
Public Clones FHCRC-GT-S6-11D1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101903 (Chr10:75411057..75411154 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101903 (Chr10:75411057..75411154 +)
Downstram Exon
ENSMUSE00000715029 (Chr10:75411888..75412382 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709612 Chr10:75405802..75406035 No primer for this exon
upstream ENSMUSE00000101903 Chr10:75411057..75411154 No primer for this exon

*** Putative Vector Insertion (Chr 10: 75411155 - 75411887) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000101906 Chr10:75411888..75412391 No primer for this exon
downstream ENSMUSE00000715029 Chr10:75411888..75412382 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGCCTCTGCTCCTGATAG Chr10:75411121..75411141 60.11 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACCTTTGTGGCAGGTACG Chr10:75411141..75411161 60.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000903