Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14566
Trapped Gene
Ptgfrn (ENSMUSG00000027864)
Vector Insertion
Chr 3: 100884050 - 100914090
Public Clones (sanger) D187C12 (ggtc) FHCRC-GT-S6-10F1 (fhcrc) IST10921E10 (tigm)
IST14989D10 (tigm) IST10921E10 (tigm) IST11308B4 (tigm) IST11621G7 (tigm)
IST11621G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662316 (Chr3:100914015..100914089 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662316 (Chr3:100914015..100914089 -)
Downstram Exon
ENSMUSE00000662315 (Chr3:100884051..100884419 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTAGCAAGCTCCACGAAAC Chr3:100884231..100884250 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662316 Chr3:100914015..100914089 No primer for this exon
upstream ENSMUSE00000662315 Chr3:100884051..100884419 CGACTGGAGCTTCTCGTCTT Chr3:100884282..100884301 59.74 55

*** Putative Vector Insertion (Chr 3: 100884050 - 100914090) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000319945 Chr3:100880966..100881379 TCTGTGATCCACTCGCTGAC Chr3:100881012..100881031 59.99 55
downstream ENSMUSE00000319939 Chr3:100876733..100877113 TCATCCACACGGTCTGTTGT Chr3:100877001..100877020 60.01 50
downstream ENSMUSE00000319933 Chr3:100864560..100864985 CTTTGGATCCGGAAATTGAA Chr3:100864666..100864685 59.87 40
downstream ENSMUSE00000319924 Chr3:100860159..100860578 TTCGGTATCGGAACTCATCC Chr3:100860272..100860291 59.89 50
downstream ENSMUSE00000319916 Chr3:100854013..100854120 CTGAATGCACAGAGGCGTTA Chr3:100854069..100854088 60.01 50
downstream ENSMUSE00000319910 Chr3:100849367..100849672 AAGAATTCCAGCACGCTCAC Chr3:100849488..100849507 60.41 50
downstream ENSMUSE00000662314 Chr3:100844159..100847445 TTAAGGCTAAGGTGGCGAGA Chr3:100846537..100846556 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGTAGTTCTCACCAGGA Chr3:100902039..100902059 60.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGTAGTTCTCACCAGGA Chr3:100902039..100902059 60.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027864