Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14571
Trapped Gene
B4galt1 (ENSMUSG00000028413)
Vector Insertion
Chr 4: 40751634 - 40754871
Public Clones FHCRC-GT-S8-7C1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178955 (Chr4:40754766..40754870 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGATCCGGCATTCAAGAG Chr4:40754794..40754813 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178955 (Chr4:40754766..40754870 -)
Downstram Exon
ENSMUSE00000297378 (Chr4:40751635..40754350 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGATCCGGCATTCAAGAG Chr4:40754794..40754813 60.04 45 CATGTTGACACCAGGGTGAG Chr4:40751918..40751937 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437529 Chr4:40800424..40801031 GGCGTCACCCTCGTCTATTA Chr4:40800717..40800736 60.1 55
upstream ENSMUSE00000178953 Chr4:40770472..40770707 CATCATCCCATTCCGTAACC Chr4:40770561..40770580 60.01 50
upstream ENSMUSE00000178949 Chr4:40759718..40759905 CAATGGACAAGTTCGGGTTT Chr4:40759720..40759739 59.83 45
upstream ENSMUSE00000178956 Chr4:40756712..40756834 GCCATCAATGGATTCCCTAA Chr4:40756757..40756776 59.72 45
upstream ENSMUSE00000675552 Chr4:40756359..40756437 ACTTTCACCTGCAAGCACAA Chr4:40756367..40756386 59.49 45
upstream ENSMUSE00000178955 Chr4:40754766..40754870 AATGATCCGGCATTCAAGAG Chr4:40754794..40754813 60.04 45
upstream ENSMUSE00000297378 Chr4:40751635..40754350 GCCTCCTTCCCTAAAATTCG Chr4:40752903..40752922 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCCCTTTACTCTTGGCAGA Chr4:40751868..40751889 59.86 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCCCTTTACTCTTGGCAGA Chr4:40751868..40751889 59.86 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028413