Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14575
Trapped Gene
Marcksl1 (ENSMUSG00000047945)
Vector Insertion
Chr 4: 129191161 - 129191960
Public Clones CMHD-GT_386B11-3 (cmhd) FHCRC-GT-S8-6A1 (fhcrc)
Private Clones OST465685 (lexicon) OST445215 (lexicon) OST440036 (lexicon) OST371259 (lexicon)
OST353117 (lexicon) OST302815 (lexicon) OST284310 (lexicon) OST281347 (lexicon)
OST279056 (lexicon) OST276340 (lexicon) OST273885 (lexicon) OST266412 (lexicon)
OST263166 (lexicon) OST223766 (lexicon) OST184478 (lexicon) OST171138 (lexicon)
OST117893 (lexicon) OST105447 (lexicon) OST83051 (lexicon) OST15895 (lexicon)
OST14499 (lexicon) OST7515 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000338394 (Chr4:129190875..129191160 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000338394 (Chr4:129190875..129191160 +)
Downstram Exon
ENSMUSE00000381544 (Chr4:129191961..129193218 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTCTTCTTGGGGGTCTCCTT Chr4:129192142..129192161 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000338394 Chr4:129190875..129191160 No primer for this exon

*** Putative Vector Insertion (Chr 4: 129191161 - 129191960) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381544 Chr4:129191961..129193218 TTCTTCTTGGGGGTCTCCTT Chr4:129192142..129192161 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr4:129191212..129191232 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000047945