Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14578
Trapped Gene
Fryl (ENSMUSG00000070733)
Vector Insertion
Chr 5: 73539255 - 73559679
Public Clones FHCRC-GT-S8-3D1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000462436 (Chr5:73559450..73559678 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCAGAGCCACAGAATTG Chr5:73559594..73559613 60.94 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000462436 (Chr5:73559450..73559678 -)
Downstram Exon
ENSMUSE00000709128 (Chr5:73539256..73539461 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCAGAGCCACAGAATTG Chr5:73559594..73559613 60.94 55 ACATATTCACCGGGCTTGAC Chr5:73539307..73539326 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000652773 Chr5:73647639..73647857 TCCCGATCGGATTATTCCTT Chr5:73647740..73647759 60.6 45
upstream ENSMUSE00000652772 Chr5:73612147..73612311 CTGCTCCAGGTTGAAGAAGC Chr5:73612218..73612237 60.13 55
upstream ENSMUSE00000696294 Chr5:73586225..73586352 CAAGAACTTAGCCGGGAGTG Chr5:73586233..73586252 59.87 55
upstream ENSMUSE00000462436 Chr5:73559450..73559678 GAGCCAGAGCCACAGAATTG Chr5:73559594..73559613 60.94 55
upstream ENSMUSE00000341324 Chr5:73539256..73539461 AAGAAAGAGCGCCATCATGT Chr5:73539372..73539391 59.84 45
upstream ENSMUSE00000709128 Chr5:73539256..73539461 AAGAAAGAGCGCCATCATGT Chr5:73539372..73539391 59.84 45
upstream ENSMUSE00000716364 Chr5:73539256..73539461 AAGAAAGAGCGCCATCATGT Chr5:73539372..73539391 59.84 45

*** Putative Vector Insertion (Chr 5: 73539255 - 73559679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000228813 Chr5:73527561..73527614 ACCCCTCTGAAGAGATCTGGA Chr5:73527560..73527580 60.2 52.38
downstream ENSMUSE00000696234 Chr5:73527561..73527614 ACCCCTCTGAAGAGATCTGGA Chr5:73527560..73527580 60.2 52.38
downstream ENSMUSE00000228809 Chr5:73524485..73524624 TAGGATTCATCGTCGGTTCC Chr5:73524499..73524518 59.89 50
downstream ENSMUSE00000696233 Chr5:73524485..73524624 TAGGATTCATCGTCGGTTCC Chr5:73524499..73524518 59.89 50
downstream ENSMUSE00000228801 Chr5:73523710..73523806 GTAATCTCTCTCGCGGTGCT Chr5:73523757..73523776 59.6 55
downstream ENSMUSE00000696232 Chr5:73523710..73523806 GTAATCTCTCTCGCGGTGCT Chr5:73523757..73523776 59.6 55
downstream ENSMUSE00000598421 Chr5:73516754..73516833 GGCACAGGATGAACAGGAAT Chr5:73516792..73516811 59.93 50
downstream ENSMUSE00000696231 Chr5:73516754..73516833 GGCACAGGATGAACAGGAAT Chr5:73516792..73516811 59.93 50
downstream ENSMUSE00000228785 Chr5:73515922..73516002 AAATCCGCAATGATATGCAC Chr5:73515936..73515955 58.46 40
downstream ENSMUSE00000696229 Chr5:73515922..73516002 AAATCCGCAATGATATGCAC Chr5:73515936..73515955 58.46 40
downstream ENSMUSE00000598420 Chr5:73513452..73513620 TGCATGAACTGAAAGGATGC Chr5:73513431..73513450 59.81 45
downstream ENSMUSE00000696227 Chr5:73513452..73513620 TGCATGAACTGAAAGGATGC Chr5:73513431..73513450 59.81 45
downstream ENSMUSE00000443187 Chr5:73513103..73513195 ACGGGGATAAGGATCTCCAC Chr5:73513088..73513107 60.15 55
downstream ENSMUSE00000696226 Chr5:73513103..73513195 ACGGGGATAAGGATCTCCAC Chr5:73513088..73513107 60.15 55
downstream ENSMUSE00000598419 Chr5:73511057..73511155 CAGCGAATGCTTCTTTCTGG Chr5:73511035..73511054 61.04 50
downstream ENSMUSE00000696225 Chr5:73511057..73511155 CAGCGAATGCTTCTTTCTGG Chr5:73511035..73511054 61.04 50
downstream ENSMUSE00000598418 Chr5:73509723..73509824 No primer for this exon
downstream ENSMUSE00000696224 Chr5:73509723..73509824 No primer for this exon
downstream ENSMUSE00000513074 Chr5:73503988..73504091 CTCCAGTGCAACTCGAGACA Chr5:73504034..73504053 60.18 55
downstream ENSMUSE00000696223 Chr5:73503988..73504091 CTCCAGTGCAACTCGAGACA Chr5:73504034..73504053 60.18 55
downstream ENSMUSE00000510113 Chr5:73503602..73503710 CCTTTGGGAAAAGAGCAGAC Chr5:73503651..73503670 58.91 50
downstream ENSMUSE00000696222 Chr5:73503602..73503710 CCTTTGGGAAAAGAGCAGAC Chr5:73503651..73503670 58.91 50
downstream ENSMUSE00000507429 Chr5:73501425..73501511 TTCATTGCAAAATCCAAACG Chr5:73501467..73501486 59.54 35
downstream ENSMUSE00000696221 Chr5:73501425..73501511 TTCATTGCAAAATCCAAACG Chr5:73501467..73501486 59.54 35
downstream ENSMUSE00000598417 Chr5:73499709..73499880 TGACTTTGGCCTCTTCGTCT Chr5:73499690..73499709 59.99 50
downstream ENSMUSE00000696220 Chr5:73499709..73499880 TGACTTTGGCCTCTTCGTCT Chr5:73499690..73499709 59.99 50
downstream ENSMUSE00000509449 Chr5:73499202..73499334 CACATTGGTCTCCCAACCTC Chr5:73499228..73499247 60.36 55
downstream ENSMUSE00000696219 Chr5:73499202..73499334 CACATTGGTCTCCCAACCTC Chr5:73499228..73499247 60.36 55
downstream ENSMUSE00000652775 Chr5:73495914..73496021 CATACCATCGGGAATCAACC Chr5:73495924..73495943 60.01 50
downstream ENSMUSE00000696218 Chr5:73495914..73496021 CATACCATCGGGAATCAACC Chr5:73495924..73495943 60.01 50
downstream ENSMUSE00000506459 Chr5:73492693..73492930 GGGGTGGACATCAGTCACTT Chr5:73492764..73492783 59.82 55
downstream ENSMUSE00000696217 Chr5:73492693..73492930 GGGGTGGACATCAGTCACTT Chr5:73492764..73492783 59.82 55
downstream ENSMUSE00000519126 Chr5:73491525..73491710 TCTCTCGAAGGACGCTGACT Chr5:73491538..73491557 60.28 55
downstream ENSMUSE00000696216 Chr5:73491525..73491710 TCTCTCGAAGGACGCTGACT Chr5:73491538..73491557 60.28 55
downstream ENSMUSE00000696215 Chr5:73491185..73491271 CGTGAGGTGGATGAAGCTCT Chr5:73491175..73491194 60.41 55
downstream ENSMUSE00000696278 Chr5:73491185..73491271 CGTGAGGTGGATGAAGCTCT Chr5:73491175..73491194 60.41 55
downstream ENSMUSE00000508530 Chr5:73490753..73491271 CAGACGTGGGTGTGTATTCG Chr5:73491096..73491115 60.03 55
downstream ENSMUSE00000696214 Chr5:73489398..73489666 AGGGGCTGATCACATCAAAC Chr5:73489548..73489567 59.93 50
downstream ENSMUSE00000696277 Chr5:73489398..73489666 AGGGGCTGATCACATCAAAC Chr5:73489548..73489567 59.93 50
downstream ENSMUSE00000696213 Chr5:73488613..73488808 GCTCGTGGTGGCATTTACTT Chr5:73488747..73488766 60.14 50
downstream ENSMUSE00000696276 Chr5:73488613..73488808 GCTCGTGGTGGCATTTACTT Chr5:73488747..73488766 60.14 50
downstream ENSMUSE00000696212 Chr5:73487513..73487637 AGGCCTAGAACGAGGGACTC Chr5:73487518..73487537 59.84 60
downstream ENSMUSE00000696275 Chr5:73487513..73487637 AGGCCTAGAACGAGGGACTC Chr5:73487518..73487537 59.84 60
downstream ENSMUSE00000696211 Chr5:73486655..73486712 TCTGGCCTTCTTTCAAGTGC Chr5:73486634..73486653 60.52 50
downstream ENSMUSE00000696274 Chr5:73486655..73486712 TCTGGCCTTCTTTCAAGTGC Chr5:73486634..73486653 60.52 50
downstream ENSMUSE00000696210 Chr5:73484362..73484453 TGGCTAATGACACCAGCATC Chr5:73484343..73484362 59.68 50
downstream ENSMUSE00000696273 Chr5:73484362..73484453 TGGCTAATGACACCAGCATC Chr5:73484343..73484362 59.68 50
downstream ENSMUSE00000696209 Chr5:73481840..73482012 TGTCGGAGTCCTTCTCGTTT Chr5:73481881..73481900 59.84 50
downstream ENSMUSE00000696272 Chr5:73481840..73482012 TGTCGGAGTCCTTCTCGTTT Chr5:73481881..73481900 59.84 50
downstream ENSMUSE00000696208 Chr5:73480334..73480494 GGCGTGAACATGATGCTAAA Chr5:73480373..73480392 59.69 45
downstream ENSMUSE00000696271 Chr5:73480334..73480494 GGCGTGAACATGATGCTAAA Chr5:73480373..73480392 59.69 45
downstream ENSMUSE00000696207 Chr5:73479608..73479718 CAGGGCCACAACACAGTACA Chr5:73479666..73479685 60.63 55
downstream ENSMUSE00000696269 Chr5:73479608..73479718 CAGGGCCACAACACAGTACA Chr5:73479666..73479685 60.63 55
downstream ENSMUSE00000696206 Chr5:73478117..73478271 AGCAACGTGACTGCTTCACA Chr5:73478215..73478234 60.66 50
downstream ENSMUSE00000696268 Chr5:73478117..73478271 AGCAACGTGACTGCTTCACA Chr5:73478215..73478234 60.66 50
downstream ENSMUSE00000696205 Chr5:73477766..73477865 No primer for this exon
downstream ENSMUSE00000696267 Chr5:73477766..73477865 No primer for this exon
downstream ENSMUSE00000696204 Chr5:73476586..73476754 CTCCATCCGTTCTCTGAACC Chr5:73476672..73476691 59.65 55
downstream ENSMUSE00000696265 Chr5:73476586..73476754 CTCCATCCGTTCTCTGAACC Chr5:73476672..73476691 59.65 55
downstream ENSMUSE00000696203 Chr5:73474367..73474626 CCATGAGCTCTCGGTCTTTC Chr5:73474437..73474456 59.95 55
downstream ENSMUSE00000696264 Chr5:73474367..73474626 CCATGAGCTCTCGGTCTTTC Chr5:73474437..73474456 59.95 55
downstream ENSMUSE00000696202 Chr5:73474036..73474176 GAGGCTTGGTTCGCTATTCA Chr5:73474023..73474042 60.35 50
downstream ENSMUSE00000696263 Chr5:73474036..73474176 GAGGCTTGGTTCGCTATTCA Chr5:73474023..73474042 60.35 50
downstream ENSMUSE00000696201 Chr5:73472203..73472371 GAGGTGACGGAAGGGATTTT Chr5:73472183..73472202 60.31 50
downstream ENSMUSE00000696262 Chr5:73472203..73472371 GAGGTGACGGAAGGGATTTT Chr5:73472183..73472202 60.31 50
downstream ENSMUSE00000696200 Chr5:73467897..73467981 GGAGCGACCATTGTATTGCT Chr5:73467926..73467945 60.1 50
downstream ENSMUSE00000696261 Chr5:73467897..73467981 GGAGCGACCATTGTATTGCT Chr5:73467926..73467945 60.1 50
downstream ENSMUSE00000598462 Chr5:73467127..73467239 TTCAGTCCCCCGTAGATGTC Chr5:73467185..73467204 59.93 55
downstream ENSMUSE00000696260 Chr5:73467127..73467239 TTCAGTCCCCCGTAGATGTC Chr5:73467185..73467204 59.93 55
downstream ENSMUSE00000598461 Chr5:73465868..73466018 GATGCTGTTTCAGGCACGTA Chr5:73465867..73465886 59.87 50
downstream ENSMUSE00000696259 Chr5:73465868..73466018 GATGCTGTTTCAGGCACGTA Chr5:73465867..73465886 59.87 50
downstream ENSMUSE00000598460 Chr5:73465081..73465184 TTCACGCTGTGGTCAATGAT Chr5:73465109..73465128 60.12 45
downstream ENSMUSE00000696258 Chr5:73465081..73465184 TTCACGCTGTGGTCAATGAT Chr5:73465109..73465128 60.12 45
downstream ENSMUSE00000598459 Chr5:73463975..73464160 TTGCAGTGCTCGTACACCTC Chr5:73464099..73464118 60.06 55
downstream ENSMUSE00000696257 Chr5:73463975..73464160 TTGCAGTGCTCGTACACCTC Chr5:73464099..73464118 60.06 55
downstream ENSMUSE00000598458 Chr5:73462344..73462548 ATAGGGGACGGCTGGTAATC Chr5:73462484..73462503 60.17 55
downstream ENSMUSE00000696256 Chr5:73462344..73462548 ATAGGGGACGGCTGGTAATC Chr5:73462484..73462503 60.17 55
downstream ENSMUSE00000598457 Chr5:73461122..73461243 AAACGTCCTCATGGTTCCAA Chr5:73461187..73461206 60.35 45
downstream ENSMUSE00000598456 Chr5:73459963..73460153 GGAGAGGACATCGGAGAGTG Chr5:73459983..73460002 59.79 60
downstream ENSMUSE00000598455 Chr5:73458513..73458607 TTCATGGTTTCAGCCAAGGT Chr5:73458521..73458540 60.49 45
downstream ENSMUSE00000598454 Chr5:73456178..73456785 CCGGGGAAGTTACTCCATTT Chr5:73456278..73456297 60.18 50
downstream ENSMUSE00000598453 Chr5:73455745..73455842 AGTTGGGCTGTCAAAATGCT Chr5:73455759..73455778 59.74 45
downstream ENSMUSE00000598452 Chr5:73450618..73450788 CAAGACTGAAGGTCGCCTCT Chr5:73450613..73450632 59.6 55
downstream ENSMUSE00000598451 Chr5:73448963..73449103 TGTAGCAACGACTGCTGCAT Chr5:73449038..73449057 60.63 50
downstream ENSMUSE00000598450 Chr5:73446764..73446961 GAGCCTACGTCCACTCCGTA Chr5:73446830..73446849 60.28 60
downstream ENSMUSE00000598449 Chr5:73445955..73446116 GAACTAGGGCGTTGGATGTG Chr5:73445965..73445984 60.52 55
downstream ENSMUSE00000598448 Chr5:73445769..73445843 GCACGCTCATCAGCTTCTCT Chr5:73445791..73445810 60.85 55
downstream ENSMUSE00000598447 Chr5:73445292..73445468 TTCGACGGCAACTTCTTCTT Chr5:73445345..73445364 59.99 45
downstream ENSMUSE00000598446 Chr5:73441541..73441744 TATCCTCCTGGTTCGTCAGG Chr5:73441584..73441603 60.06 55
downstream ENSMUSE00000598445 Chr5:73438759..73438923 GGGTCTCGTCTCTGATCTGC Chr5:73438784..73438803 59.95 60
downstream ENSMUSE00000598444 Chr5:73432585..73432832 AGATGGACTCGGGGTAGCTT Chr5:73432645..73432664 60.1 55
downstream ENSMUSE00000598443 Chr5:73426185..73426392 CGACAGCGTCTGATTGACAT Chr5:73426220..73426239 59.86 50
downstream ENSMUSE00000598442 Chr5:73424835..73424984 TGGTACCAATGCGCTGTAGA Chr5:73424884..73424903 60.28 50
downstream ENSMUSE00000598441 Chr5:73423997..73424095 CAAGACGCCAAACTTGAGTG Chr5:73424029..73424048 59.49 50
downstream ENSMUSE00000598440 Chr5:73418555..73418623 ACCGAATGTCCTCTTGCAGT Chr5:73418572..73418591 59.73 50
downstream ENSMUSE00000598439 Chr5:73415127..73415237 GTTTGCAGTAGGCCTGGAAC Chr5:73415143..73415162 59.74 55
downstream ENSMUSE00000598438 Chr5:73413741..73413931 GCCGCTTTGGAGATATCAAT Chr5:73413812..73413831 59.14 45
downstream ENSMUSE00000598437 Chr5:73411430..73413536 CGTTGGGAGGCTACATTCAT Chr5:73411859..73411878 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCATGTCTGGGAAATTTGT Chr5:73544655..73544675 59.8 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATAGAAAGGCCGTGACTGG Chr5:73556619..73556639 60.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070733