Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14590
Trapped Gene
Zmat5 (ENSMUSG00000009076)
Vector Insertion
Chr 11: 4604725 - 4622360
Public Clones (sanger) (sanger) (sanger) E114C01 (ggtc) E114C01 (ggtc) E114D02 (ggtc)
FHCRC-GT-S17-8G1 (fhcrc) IST14572D9 (tigm) IST11645F3 (tigm) IST14978E8 (tigm)
IST14617C5 (tigm) IST14220F10 (tigm) IST12793C8 (tigm)
Private Clones OST453991 (lexicon) OST441541 (lexicon) OST431875 (lexicon) OST421442 (lexicon)
OST391918 (lexicon) OST376687 (lexicon) OST372881 (lexicon) OST367547 (lexicon)
OST320492 (lexicon) OST308943 (lexicon) OST303065 (lexicon) OST296369 (lexicon)
OST282163 (lexicon) OST276026 (lexicon) OST273283 (lexicon) OST269305 (lexicon)
OST262637 (lexicon) OST258353 (lexicon) OST207161 (lexicon) OST166691 (lexicon)
OST166574 (lexicon) OST154999 (lexicon) OST138653 (lexicon) OST134473 (lexicon)
OST134472 (lexicon) OST130963 (lexicon) OST111980 (lexicon) OST104604 (lexicon)
OST98905 (lexicon) OST87618 (lexicon) OST65297 (lexicon) OST65290 (lexicon)
OST62738 (lexicon) OST55529 (lexicon) OST31119 (lexicon) OST25181 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104283 (Chr11:4604688..4604724 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104283 (Chr11:4604688..4604724 +)
Downstram Exon
ENSMUSE00000104287 (Chr11:4622361..4622514 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000104283 Chr11:4604688..4604724 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4604725 - 4622360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104287 Chr11:4622361..4622514 No primer for this exon
downstream ENSMUSE00000104281 Chr11:4628588..4628650 No primer for this exon
downstream ENSMUSE00000104286 Chr11:4630190..4630270 No primer for this exon
downstream ENSMUSE00000104279 Chr11:4632070..4632181 No primer for this exon
downstream ENSMUSE00000442230 Chr11:4637335..4637535 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTAATCGCCTTGCAGCAC Chr11:4604773..4604793 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGGAGGATCGTGACTGG Chr11:4610765..4610785 60.82 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009076