Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14595
Trapped Gene
AC182749.2-203 (ENSMUSG00000079709)
Vector Insertion
Chr 17: 15115864 - 15116464
Public Clones (sanger) (sanger) (sanger) FHCRC-GT-S17-12D1 (fhcrc) PST22931-NR (escells)
IST10459B1 (tigm) IST10772B9 (tigm) IST11320A5 (tigm) IST14652G7 (tigm)
Private Clones OST431255 (lexicon) OST420187 (lexicon) OST338180 (lexicon) OST309374 (lexicon)
OST307992 (lexicon) OST278820 (lexicon) OST263048 (lexicon) OST225410 (lexicon)
OST205325 (lexicon) OST198851 (lexicon) OST186099 (lexicon) OST126189 (lexicon)
OST86214 (lexicon) OST82248 (lexicon) OST64185 (lexicon) OST49179 (lexicon)
OST38647 (lexicon) OST32766 (lexicon) OST32764 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716076 (Chr17:15115829..15115863 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716076 (Chr17:15115829..15115863 +)
Downstram Exon
ENSMUSE00000658235 (Chr17:15116465..15116633 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCATGGAATCCCCTGGTAAA Chr17:15116489..15116508 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716076 Chr17:15115829..15115863 No primer for this exon

*** Putative Vector Insertion (Chr 17: 15115864 - 15116464) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658235 Chr17:15116465..15116633 TCATGGAATCCCCTGGTAAA Chr17:15116489..15116508 60.13 45
downstream ENSMUSE00000703662 Chr17:15117222..15117361 TTTCAAACTGAGCCCTGGTC Chr17:15117323..15117342 60.23 50
downstream ENSMUSE00000703661 Chr17:15118540..15118641 AGCTTTGCAAGGCATCAAGT Chr17:15118576..15118595 60.02 45
downstream ENSMUSE00000703660 Chr17:15119264..15119353 GCATGTCCAAAGACTTGTGC Chr17:15119352..15119371 59.3 50
downstream ENSMUSE00000658227 Chr17:15119853..15119873 No primer for this exon
downstream ENSMUSE00000703658 Chr17:15121782..15121879 TGCCACAAGACGTTTCTCAG Chr17:15121849..15121868 60.03 50
downstream ENSMUSE00000703657 Chr17:15122738..15122874 GGTGACCTTTGTGTGGTGAA Chr17:15122819..15122838 59.42 50
downstream ENSMUSE00000703656 Chr17:15123682..15123796 TTCCCAATATGGCAACATGA Chr17:15123770..15123789 59.74 40
downstream ENSMUSE00000703652 Chr17:15124560..15124662 AACATGGTGTAGTCGGCAAA Chr17:15124583..15124602 59.05 45
downstream ENSMUSE00000703649 Chr17:15125038..15125067 No primer for this exon
downstream ENSMUSE00000703648 Chr17:15125862..15125930 CAAGGAAGCTGGTTCATGCT Chr17:15125911..15125930 60.4 50
downstream ENSMUSE00000658240 Chr17:15127511..15127768 GTTGATCTCCCCATGGCTTA Chr17:15127588..15127607 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTCCCATCCCTTATTCTGA Chr17:15115881..15115901 59.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTCCCATCCCTTATTCTGA Chr17:15115881..15115901 59.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079709