Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14615
Trapped Gene
Ppp4c (ENSMUSG00000030697)
Vector Insertion
Chr 7: 133932537 - 133935738
Public Clones (sanger) D009E08 (ggtc) D168C01 (ggtc) D009E08 (ggtc) (ggtc)
FHCRC-GT-S5-2G1 (fhcrc) IST14134C5 (tigm)
Private Clones OST290918 (lexicon) OST290830 (lexicon) OST282037 (lexicon) OST198771 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000202083 (Chr7:133935575..133935737 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCGAGCTGATCAAAGAGA Chr7:133935606..133935625 59.42 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000202083 (Chr7:133935575..133935737 -)
Downstram Exon
ENSMUSE00000202102 (Chr7:133932538..133932589 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCGAGCTGATCAAAGAGA Chr7:133935606..133935625 59.42 50 CTCTGCACGTTGCTCTCTTCT Chr7:133932535..133932555 59.94 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000472118 Chr7:133935937..133935985 GGAAGTGGGGAGTCGAAGAG Chr7:133935960..133935979 61.16 60
upstream ENSMUSE00000202083 Chr7:133935575..133935737 CTGCGAGCTGATCAAAGAGA Chr7:133935606..133935625 59.42 50
upstream ENSMUSE00000202102 Chr7:133932538..133932589 AGAAGAGAGCAACGTGCAGAG Chr7:133932557..133932577 59.94 52.38

*** Putative Vector Insertion (Chr 7: 133932537 - 133935738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000202096 Chr7:133931898..133931948 No primer for this exon
downstream ENSMUSE00000202105 Chr7:133931631..133931732 TGTAGAAACCACGGTCCACA Chr7:133931644..133931663 60 50
downstream ENSMUSE00000202086 Chr7:133930951..133931124 TGGGTAATCTGGCGACTCTC Chr7:133931041..133931060 60.22 55
downstream ENSMUSE00000202091 Chr7:133930734..133930860 TCATGGGGTACCTCTTGCTT Chr7:133930750..133930769 59.55 50
downstream ENSMUSE00000202099 Chr7:133929886..133930075 GCAGTAATTAGGCGCTGACC Chr7:133929869..133929888 59.87 55
downstream ENSMUSE00000408203 Chr7:133929421..133929805 TGGATCAAGTGGGAGAAAGG Chr7:133929486..133929505 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCAGGGGTTGAGTGGTAG Chr7:133932743..133932763 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTCCCTTTTCCCAGGAGAC Chr7:133932731..133932752 63.37 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCGAGCTGATCAAAGAGAGC Chr7:133932602..133932622 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCGAGCTGATCAAAGAGAGC Chr7:133932602..133932622 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030697