Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1463
Trapped Gene
Ergic1 (ENSMUSG00000001576)
Vector Insertion
Chr 17: 26698578 - 26745537
Public Clones CD0466 (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
D119G05 (ggtc) (ggtc) D124H04 (ggtc) (ggtc) D057D03 (ggtc) (ggtc)
Q012E03 (ggtc) D119G05 (ggtc) (ggtc) E044E06 (ggtc) (ggtc)
IST14139G10 (tigm) IST14233H2 (tigm) IST14656D4 (tigm) IST14572H10 (tigm)
IST14168E2 (tigm) IST14783D4 (tigm) IST14225F1 (tigm) IST14612G12 (tigm)
IST14297G2 (tigm) IST14155C10 (tigm) IST14217F1 (tigm)
Private Clones OST315279 (lexicon) OST226652 (lexicon) OST214740 (lexicon) OST130720 (lexicon)
OST114775 (lexicon) OST52413 (lexicon) OST33136 (lexicon) OST32669 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387417 (Chr17:26698471..26698577 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387417 (Chr17:26698471..26698577 +)
Downstram Exon
ENSMUSE00000251217 (Chr17:26745538..26745599 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387417 Chr17:26698471..26698577 No primer for this exon

*** Putative Vector Insertion (Chr 17: 26698578 - 26745537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251217 Chr17:26745538..26745599 No primer for this exon
downstream ENSMUSE00000139384 Chr17:26751301..26751373 No primer for this exon
downstream ENSMUSE00000139382 Chr17:26761535..26761629 No primer for this exon
downstream ENSMUSE00000139380 Chr17:26766500..26766624 No primer for this exon
downstream ENSMUSE00000139370 Chr17:26771362..26771466 No primer for this exon
downstream ENSMUSE00000139378 Chr17:26772931..26772991 No primer for this exon
downstream ENSMUSE00000139372 Chr17:26775688..26775788 No primer for this exon
downstream ENSMUSE00000139368 Chr17:26778527..26778649 No primer for this exon
downstream ENSMUSE00000373302 Chr17:26792012..26792295 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCCTAGCTGGACAGGAA Chr17:26725601..26725621 59.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCCTAGCTGGACAGGAA Chr17:26725601..26725621 59.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001576