Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14633
Trapped Gene
Ptdss2 (ENSMUSG00000025495)
Vector Insertion
Chr 7: 148333048 - 148337548
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) D076A06 (ggtc) (ggtc) D076F06 (ggtc) (ggtc)
E132G10 (ggtc) D076A06 (ggtc) (ggtc) D131G10 (ggtc) (ggtc)
CMHD-GT_522A4-5S (cmhd) FHCRC-GT-S4-2F1 (fhcrc) IST12255D7 (tigm) IST11989C12 (tigm)
IST14884E6 (tigm) IST13045C6 (tigm) IST14526F8 (tigm) IST14002E5 (tigm)
IST11636G6 (tigm) IST11696A9 (tigm) IST13727D11 (tigm) IST13207D11 (tigm)
IST14882H12 (tigm)
Private Clones OST396398 (lexicon) OST354789 (lexicon) OST312469 (lexicon) OST286805 (lexicon)
OST197617 (lexicon) OST148535 (lexicon) OST148227 (lexicon) OST85663 (lexicon)
OST41645 (lexicon) OST40097 (lexicon) OST35155 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151153 (Chr7:148332980..148333047 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGTTTTGGCTGTGTGTTAG Chr7:148332988..148333007 59.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151153 (Chr7:148332980..148333047 +)
Downstram Exon
ENSMUSE00000151158 (Chr7:148337549..148337683 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGTTTTGGCTGTGTGTTAG Chr7:148332988..148333007 59.24 50 CGTAGTCCCTCTCTGGCAAT Chr7:148337627..148337646 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341756 Chr7:148317185..148317416 ACGACGATGGCACTAACACC Chr7:148317389..148317408 60.99 55
upstream ENSMUSE00000151152 Chr7:148321208..148321309 CTGGGCTACGTGACTCTCCT Chr7:148321251..148321270 59.47 60
upstream ENSMUSE00000151160 Chr7:148328992..148329074 AAGCTAAAGACGGGCCATTT Chr7:148329039..148329058 60.1 45
upstream ENSMUSE00000151153 Chr7:148332980..148333047 CGGTTTTGGCTGTGTGTTAG Chr7:148332988..148333007 59.24 50

*** Putative Vector Insertion (Chr 7: 148333048 - 148337548) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151158 Chr7:148337549..148337683 CGTAGTCCCTCTCTGGCAAT Chr7:148337627..148337646 59.31 55
downstream ENSMUSE00000151150 Chr7:148338091..148338141 TACCAGCCAATGAAGTGTGC Chr7:148338137..148338156 59.72 50
downstream ENSMUSE00000151156 Chr7:148338674..148338787 ATCCACCAGTCACGGATCAT Chr7:148338702..148338721 60.21 50
downstream ENSMUSE00000151154 Chr7:148338874..148338992 GAGGGTCTTCATGCCACAGT Chr7:148338936..148338955 60.12 55
downstream ENSMUSE00000151155 Chr7:148340252..148340366 GCTTCCACTCAAAGCGTACC Chr7:148340319..148340338 59.88 55
downstream ENSMUSE00000151149 Chr7:148340456..148340601 CACGTTCACGAAGAAGACCA Chr7:148340560..148340579 59.87 50
downstream ENSMUSE00000151151 Chr7:148340710..148340895 GCAGTGACAGGGTGAGTGTG Chr7:148340822..148340841 60.37 60
downstream ENSMUSE00000631812 Chr7:148341233..148342053 CCAAGATACCTCCCCTAGCC Chr7:148341727..148341746 59.92 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGATTTGGCCGGATTTAAG Chr7:148336039..148336059 60.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGATTTGGCCGGATTTAAG Chr7:148336039..148336059 60.27 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025495