Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1464
Trapped Gene
Gatad2a (ENSMUSG00000036180)
Vector Insertion
Chr 8: 72498171 - 72519841
Public Clones (sanger) CD0464 (sanger) (sanger) (sanger) (sanger) (sanger)
Ex140 (baygenomics) XF324 (baygenomics) D141G12 (ggtc) W263E06 (ggtc)
(ggtc) M073E01 (ggtc) (ggtc) IST14793C6 (tigm) IST14873F8 (tigm)
IST14673C5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000450740 (Chr8:72519842..72520263 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCAACCCGGAAGTGTGAGA Chr8:72520183..72520202 60.51 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000450740 (Chr8:72519842..72520263 -)
Downstram Exon
ENSMUSE00000706480 (Chr8:72497989..72498170 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCAACCCGGAAGTGTGAGA Chr8:72520183..72520202 60.51 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000450740 Chr8:72519842..72520263 ATCAACCCGGAAGTGTGAGA Chr8:72520183..72520202 60.51 50

*** Putative Vector Insertion (Chr 8: 72498171 - 72519841) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706480 Chr8:72497989..72498170 No primer for this exon
downstream ENSMUSE00000371722 Chr8:72474552..72474653 ACACGGATCCTACCATGCTG Chr8:72474548..72474567 60.94 55
downstream ENSMUSE00000413887 Chr8:72459678..72459935 TCATCCTCCGTTAGGTCAGG Chr8:72459845..72459864 60.06 55
downstream ENSMUSE00000370942 Chr8:72441845..72441977 GCTACTGTGGTCAGGCCATT Chr8:72441854..72441873 60.14 55
downstream ENSMUSE00000332972 Chr8:72441622..72441753 TCATCCGCTCTCGTTCTTCT Chr8:72441701..72441720 60.1 50
downstream ENSMUSE00000373637 Chr8:72441342..72441431 AAGTGAGGTCTTGCCAGCAG Chr8:72441323..72441342 60.59 55
downstream ENSMUSE00000355466 Chr8:72440468..72440599 AAGCGGTGGCATGACTACTT Chr8:72440461..72440480 59.76 50
downstream ENSMUSE00000511203 Chr8:72440183..72440350 ATTGGCGACACGGATAAGTC Chr8:72440197..72440216 59.96 50
downstream ENSMUSE00000358267 Chr8:72438418..72438697 CAGGCCGACCAGGTAGATAA Chr8:72438430..72438449 60.09 55
downstream ENSMUSE00000235822 Chr8:72436822..72437123 TCCACCTTGAGTGCCTTCTT Chr8:72436939..72436958 59.84 50
downstream ENSMUSE00000235813 Chr8:72436063..72436137 TTACGTCGGGGCTTTATGAC Chr8:72436096..72436115 59.96 50
downstream ENSMUSE00000235806 Chr8:72435576..72435768 GTCTGCCAGTCCTGCTTACC Chr8:72435623..72435642 59.87 60
downstream ENSMUSE00000706479 Chr8:72432556..72433873 AGAATATGGGCTGCAATTCG Chr8:72433045..72433064 60.06 45
downstream ENSMUSE00000488596 Chr8:72432369..72433873 AGAATATGGGCTGCAATTCG Chr8:72433045..72433064 60.06 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTAAGATGGGTTGGGAATG Chr8:72513860..72513880 59.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAAGATGGGTTGGGAATG Chr8:72513860..72513880 59.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGGTTGGCCTTAAACTCTCA Chr8:72514266..72514287 59.73 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGCCTTCTAGCGCTAACCT Chr8:72505248..72505268 61.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036180