Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14644
Trapped Gene
Mrps6 (ENSMUSG00000039680)
Vector Insertion
Chr 16: 92058726 - 92099838
Public Clones (ggtc) FHCRC-GT-S3-9H1 (fhcrc)
Private Clones OST401414 (lexicon) OST69112 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717233 (Chr16:92058567..92058725 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCTACGAGTTGGCTTTGAT Chr16:92058687..92058706 60.41 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717233 (Chr16:92058567..92058725 +)
Downstram Exon
ENSMUSE00000247265 (Chr16:92099839..92099978 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCTACGAGTTGGCTTTGAT Chr16:92058687..92058706 60.41 50 TGGCTGTGACTCGAGATCCT Chr16:92099963..92099982 60.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717233 Chr16:92058567..92058725 CGCTACGAGTTGGCTTTGAT Chr16:92058687..92058706 60.41 50

*** Putative Vector Insertion (Chr 16: 92058726 - 92099838) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000247265 Chr16:92099839..92099978 TGGCTGTGACTCGAGATCCT Chr16:92099963..92099982 60.98 55
downstream ENSMUSE00000367164 Chr16:92111978..92112468 CAGCACTTGTCGGAGCATAA Chr16:92112018..92112037 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCTTCCCTCAGACCGAGT Chr16:92067733..92067753 60.65 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTGCTCAGCGCTGGTAGT Chr16:92067753..92067773 60.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039680