Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14650
Trapped Gene
Cib4 (ENSMUSG00000053194)
Vector Insertion
Chr 5: 30800404 - 30836660
Public Clones FHCRC-GT-S3-4F1 (fhcrc) IST14153A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000456766 (Chr5:30836563..30836659 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGGGCAAGCACTATAAGG Chr5:30836610..30836629 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000456766 (Chr5:30836563..30836659 -)
Downstram Exon
ENSMUSE00000456783 (Chr5:30800405..30800546 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGGGCAAGCACTATAAGG Chr5:30836610..30836629 59.86 55 ACACGTTGTCGTGGGAGAAT Chr5:30800473..30800492 60.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456790 Chr5:30848099..30848209 GTTTAGCATGGGGCAGTGTT Chr5:30848140..30848159 60 50
upstream ENSMUSE00000456769 Chr5:30847039..30847073 No primer for this exon
upstream ENSMUSE00000456766 Chr5:30836563..30836659 CTCGGGCAAGCACTATAAGG Chr5:30836610..30836629 59.86 55
upstream ENSMUSE00000456783 Chr5:30800405..30800546 GGTATTCTCCCACGACAACG Chr5:30800498..30800517 60.38 55

*** Putative Vector Insertion (Chr 5: 30800404 - 30836660) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000456762 Chr5:30790858..30790967 CTCGAGGTCCTCCTCATCAA Chr5:30790905..30790924 60.34 55
downstream ENSMUSE00000456758 Chr5:30789818..30789906 GTGTTCGAACTCGGAGAAGG Chr5:30789825..30789844 59.84 55
downstream ENSMUSE00000456775 Chr5:30787957..30788140 CCCAGAAGTGAATCCGAAAA Chr5:30788096..30788115 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTGGTGGTAATCGCCTTG Chr5:30833598..30833618 60.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCGGCTGTGTAGCATCAT Chr5:30833655..30833675 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053194