Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14654
Trapped Gene
AL450317.13 (ENSMUSG00000032534)
Vector Insertion
Chr 9: 102521140 - 102522091
Public Clones FHCRC-GT-S3-12C1 (fhcrc)
Private Clones OST456563 (lexicon) OST274456 (lexicon) OST273776 (lexicon) OST273717 (lexicon)
OST84318 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693370 (Chr9:102522022..102522090 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGGAGGCTTTGTTGGAAG Chr9:102522047..102522066 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693370 (Chr9:102522022..102522090 -)
Downstram Exon
ENSMUSE00000693350 (Chr9:102521141..102521318 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGGAGGCTTTGTTGGAAG Chr9:102522047..102522066 59.67 50 ACGGATGTCCAAGCAAGTCT Chr9:102521170..102521189 59.73 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709996 Chr9:102528234..102528454 CCTCCTCCCTATGGGACTCT Chr9:102528249..102528268 59.51 60
upstream ENSMUSE00000721515 Chr9:102528234..102528454 CCTCCTCCCTATGGGACTCT Chr9:102528249..102528268 59.51 60
upstream ENSMUSE00000693354 Chr9:102525886..102525923 CAATGAATTGGTGGCCTAGC Chr9:102525897..102525916 60.47 50
upstream ENSMUSE00000693373 Chr9:102525886..102525923 CAATGAATTGGTGGCCTAGC Chr9:102525897..102525916 60.47 50
upstream ENSMUSE00000693353 Chr9:102524026..102524058 AAAAGCCGAAGTTCGAGGAC Chr9:102524035..102524054 60.74 50
upstream ENSMUSE00000693372 Chr9:102524026..102524058 AAAAGCCGAAGTTCGAGGAC Chr9:102524035..102524054 60.74 50
upstream ENSMUSE00000693351 Chr9:102522022..102522090 GATGGAGGCTTTGTTGGAAG Chr9:102522047..102522066 59.67 50
upstream ENSMUSE00000693370 Chr9:102522022..102522090 GATGGAGGCTTTGTTGGAAG Chr9:102522047..102522066 59.67 50
upstream ENSMUSE00000583465 Chr9:102521141..102521318 TCTGGAGACTTGCTTGGACA Chr9:102521197..102521216 59.54 50
upstream ENSMUSE00000693350 Chr9:102521141..102521318 TCTGGAGACTTGCTTGGACA Chr9:102521197..102521216 59.54 50

*** Putative Vector Insertion (Chr 9: 102521140 - 102522091) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583464 Chr9:102517605..102517700 GGCCATTTCTTGCTTGGTTT Chr9:102517622..102517641 61.34 45
downstream ENSMUSE00000693348 Chr9:102517605..102517700 GGCCATTTCTTGCTTGGTTT Chr9:102517622..102517641 61.34 45
downstream ENSMUSE00000583463 Chr9:102515625..102515747 CAGACCGATCCTCTCGAAAA Chr9:102515632..102515651 60.33 50
downstream ENSMUSE00000693347 Chr9:102515625..102515747 CAGACCGATCCTCTCGAAAA Chr9:102515632..102515651 60.33 50
downstream ENSMUSE00000583462 Chr9:102509656..102509769 AAATCAGACGCTGCTTCTCC Chr9:102509702..102509721 59.58 50
downstream ENSMUSE00000634753 Chr9:102509656..102509769 AAATCAGACGCTGCTTCTCC Chr9:102509702..102509721 59.58 50
downstream ENSMUSE00000220527 Chr9:102505172..102505405 CCCGCTCAAGCTTACTGTTC Chr9:102505293..102505312 60.01 55
downstream ENSMUSE00000583461 Chr9:102505172..102505405 CCCGCTCAAGCTTACTGTTC Chr9:102505293..102505312 60.01 55
downstream ENSMUSE00000220534 Chr9:102504748..102504878 TTTTGCCTCAAGGATGAAGG Chr9:102504785..102504804 60.18 45
downstream ENSMUSE00000220540 Chr9:102503647..102503784 TGCCCTGGAGAGCTGTACTT Chr9:102503715..102503734 60.01 55
downstream ENSMUSE00000220525 Chr9:102500499..102500613 TTGCATGTTGCACTCACAGA Chr9:102500565..102500584 60.03 45
downstream ENSMUSE00000220538 Chr9:102498452..102498649 AGGAGGAACACTTGGCAGAA Chr9:102498495..102498514 59.84 50
downstream ENSMUSE00000220523 Chr9:102496838..102496924 CCCAGTTCCAGCTTCATCAC Chr9:102496826..102496845 60.66 55
downstream ENSMUSE00000583458 Chr9:102492658..102492863 CAGCTCAGATTTGGTGCTCA Chr9:102492728..102492747 60.14 50
downstream ENSMUSE00000583457 Chr9:102491038..102491317 GCTCGGTCTTTATTCCGTCA Chr9:102491252..102491271 60.21 50
downstream ENSMUSE00000220521 Chr9:102488908..102489342 GCGAGCATTGCTTCATTACA Chr9:102489104..102489123 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGGAGGCTTTGTTGGAA Chr9:102522046..102522066 59.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGATGGAGGCTTTGTTGG Chr9:102522048..102522068 59.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAGATGGAGGCTTTGTTGGA Chr9:102522047..102522067 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGATGGAGGCTTTGTTGGA Chr9:102522047..102522067 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032534