Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14655
Trapped Gene
Grik4 (ENSMUSG00000032017)
Vector Insertion
Chr 9: 42496015 - 42616708
Public Clones FHCRC-GT-S3-11B1 (fhcrc) IST10174E3 (tigm) IST14328C11 (tigm) IST11286A8 (tigm)
IST11219C8 (tigm) IST14295B3 (tigm) IST14980D7 (tigm) IST14456H3 (tigm)
IST11763A4 (tigm) IST10407A6 (tigm) IST14792C7 (tigm) IST13692F12 (tigm)
IST11286A8 (tigm) IST10261G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700835 (Chr9:42616576..42616707 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGAAGATGCCCCGTGTCTC Chr9:42616644..42616663 60.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700835 (Chr9:42616576..42616707 -)
Downstram Exon
ENSMUSE00000413585 (Chr9:42496016..42496180 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGAAGATGCCCCGTGTCTC Chr9:42616644..42616663 60.22 55 TGCAGTTTCGTACTCGCTGT Chr9:42496001..42496020 59.66 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700837 Chr9:42752410..42752576 No primer for this exon
upstream ENSMUSE00000700836 Chr9:42626953..42627057 CGAGTTGTTCCCTGCTTTTC Chr9:42626973..42626992 59.85 50
upstream ENSMUSE00000359356 Chr9:42616576..42616720 GTCCCCTCACAGCGTTATGT Chr9:42616700..42616719 60 55
upstream ENSMUSE00000700835 Chr9:42616576..42616707 TAGAAGATGCCCCGTGTCTC Chr9:42616644..42616663 60.22 55
upstream ENSMUSE00000413585 Chr9:42496016..42496180 No primer for this exon

*** Putative Vector Insertion (Chr 9: 42496015 - 42616708) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215821 Chr9:42483296..42483393 TGTTGCTGATGATGGAGCTG Chr9:42483291..42483310 60.99 50
downstream ENSMUSE00000215820 Chr9:42479221..42479386 GGTTCAGGGTGGTGAATCTC Chr9:42479295..42479314 59.36 55
downstream ENSMUSE00000215833 Chr9:42467801..42467979 TGTCTTGTCATCCCGGATCT Chr9:42467833..42467852 60.47 50
downstream ENSMUSE00000215828 Chr9:42463570..42463623 No primer for this exon
downstream ENSMUSE00000268586 Chr9:42437060..42437221 GCATGGGATTGGTTGAAAAT Chr9:42437117..42437136 59.63 40
downstream ENSMUSE00000268562 Chr9:42431009..42431161 GTTCCTGTACCGCTGTCACC Chr9:42431082..42431101 60.58 60
downstream ENSMUSE00000215832 Chr9:42430142..42430246 AATTCAATGTGGCCGGTAAG Chr9:42430190..42430209 59.82 45
downstream ENSMUSE00000215830 Chr9:42405937..42406044 AGATGTTGGAGGCGTAGAGG Chr9:42405959..42405978 59.31 55
downstream ENSMUSE00000215819 Chr9:42399433..42399636 TGTCCACACAGAATCCCTCA Chr9:42399536..42399555 60.09 50
downstream ENSMUSE00000215824 Chr9:42374382..42374495 ACTTTCTCACGTTCCGCTGT Chr9:42374421..42374440 59.91 50
downstream ENSMUSE00000215823 Chr9:42358490..42358599 AAAGGGATCCAGGAAGGAGA Chr9:42358539..42358558 60.01 50
downstream ENSMUSE00000215826 Chr9:42355650..42355823 CTGACACAGCGGGTAGACAA Chr9:42355637..42355656 59.9 55
downstream ENSMUSE00000215818 Chr9:42351841..42352006 ACAGACTCAATGGGCACCTC Chr9:42351892..42351911 60.12 55
downstream ENSMUSE00000215817 Chr9:42349905..42350130 CACATGCGTTGGTAGGTCTG Chr9:42350077..42350096 60.17 55
downstream ENSMUSE00000215831 Chr9:42345397..42345525 CTTCCGCTTCAGAATTTCCA Chr9:42345424..42345443 60.32 45
downstream ENSMUSE00000268446 Chr9:42332563..42332681 GAACCACAAAGATTCCACCAA Chr9:42332621..42332641 59.82 42.86
downstream ENSMUSE00000400522 Chr9:42328495..42329268 ATGTTGCGCAGTTCTGTCAC Chr9:42329206..42329225 59.91 50
downstream ENSMUSE00000700834 Chr9:42326218..42329268 TAGACGCACGTAGCAACTGG Chr9:42326396..42326415 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCCGATTAAAAATGAAATAAA Chr9:42616731..42616755 59.11 25 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGCCGATTAAAAATGAAATAAA Chr9:42616731..42616755 59.11 25 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032017