Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14666
Trapped Gene
Mad1l1 (ENSMUSG00000029554)
Vector Insertion
Chr 5: 140737451 - 140771803
Public Clones D103B06 (ggtc) D103B06 (ggtc) E002C05 (ggtc) FHCRC-GT-S2-2C1 (fhcrc)
Private Clones OST79667 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000534943 (Chr5:140771741..140771802 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACTTGCAAAGCTGCAGAGC Chr5:140771779..140771798 59.52 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000534943 (Chr5:140771741..140771802 -)
Downstram Exon
ENSMUSE00000534942 (Chr5:140737452..140737538 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACTTGCAAAGCTGCAGAGC Chr5:140771779..140771798 59.52 50 CTCTCGCTGCTGTAGCTCAA Chr5:140737468..140737487 59.64 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409080 Chr5:140797461..140797506 No primer for this exon
upstream ENSMUSE00000534978 Chr5:140790944..140791106 TCAGGGTCCCTACAGAAGCA Chr5:140790963..140790982 60.79 55
upstream ENSMUSE00000717042 Chr5:140790944..140791106 TCAGGGTCCCTACAGAAGCA Chr5:140790963..140790982 60.79 55
upstream ENSMUSE00000534975 Chr5:140786549..140786689 CCGCTCAAAGTCCTACCTCA Chr5:140786647..140786666 60.39 55
upstream ENSMUSE00000534973 Chr5:140783545..140783724 GAGGTAGATCGCAACCAGGA Chr5:140783702..140783721 60.22 55
upstream ENSMUSE00000534967 Chr5:140779527..140779651 GTGCCATGGACCAGAAGGTA Chr5:140779589..140779608 60.92 55
upstream ENSMUSE00000534961 Chr5:140778869..140778950 GGCAAGAGGCAAATCAGAAG Chr5:140778926..140778945 59.96 50
upstream ENSMUSE00000534954 Chr5:140776388..140776518 ATGGAGCGTGAGCTGAAGAG Chr5:140776415..140776434 60.7 55
upstream ENSMUSE00000534947 Chr5:140776169..140776283 GGTTGACCTGGAGTTGGAAA Chr5:140776174..140776193 59.94 50
upstream ENSMUSE00000534943 Chr5:140771741..140771802 TACTTGCAAAGCTGCAGAGC Chr5:140771779..140771798 59.52 50
upstream ENSMUSE00000534942 Chr5:140737452..140737538 TTGAGCTACAGCAGCGAGAG Chr5:140737490..140737509 59.64 55

*** Putative Vector Insertion (Chr 5: 140737451 - 140771803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000534940 Chr5:140669868..140670012 CAAGTGCCTCATGTGTCTCC Chr5:140669884..140669903 59.26 55
downstream ENSMUSE00000648354 Chr5:140650487..140650576 CTAAGTGACCGGGACCACTG Chr5:140650506..140650525 60.56 60
downstream ENSMUSE00000534939 Chr5:140619874..140620014 GAGCTGTGGGCATGTACCTT Chr5:140619862..140619881 60.14 55
downstream ENSMUSE00000534937 Chr5:140608723..140608779 CTCTGCTTCTGAACCCCAAG Chr5:140608711..140608730 59.98 55
downstream ENSMUSE00000534934 Chr5:140593191..140593279 GAGTGCATCCACCTCCTCTT Chr5:140593171..140593190 59.26 55
downstream ENSMUSE00000190014 Chr5:140581469..140581559 CAGCACCTGCTTTTCCTGTT Chr5:140581477..140581496 60.43 50
downstream ENSMUSE00000414361 Chr5:140564584..140564791 TAAGCGCTCACATTCCTCCT Chr5:140564653..140564672 59.98 50
downstream ENSMUSE00000685603 Chr5:140564584..140564791 TAAGCGCTCACATTCCTCCT Chr5:140564653..140564672 59.98 50
downstream ENSMUSE00000534930 Chr5:140541768..140541958 CCTGGATCTTGGTCTGGAAA Chr5:140541862..140541881 60.04 50
downstream ENSMUSE00000685602 Chr5:140541768..140541958 CCTGGATCTTGGTCTGGAAA Chr5:140541862..140541881 60.04 50
downstream ENSMUSE00000534929 Chr5:140484643..140485228 AGGCACAGACCGTGAGAACT Chr5:140485144..140485163 59.91 55
downstream ENSMUSE00000648353 Chr5:140484643..140485228 AGGCACAGACCGTGAGAACT Chr5:140485144..140485163 59.91 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTTGGGGTTGAGACTACTT Chr5:140765774..140765795 59.35 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGTTGGGGTTGAGACTAC Chr5:140765776..140765796 60.61 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCTTTTGTTAATCGCCTTG Chr5:140765678..140765698 58.96 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGATGTGTGGGATGTGCTT Chr5:140741766..140741786 60.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029554