Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1467
Trapped Gene
Ndufa9 (ENSMUSG00000000399)
Vector Insertion
Chr 6: 126786340 - 126790515
Public Clones CD0450 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240808 (Chr6:126790516..126790657 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240808 (Chr6:126790516..126790657 -)
Downstram Exon
ENSMUSE00000197646 (Chr6:126786237..126786339 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000240837 Chr6:126799082..126799140 No primer for this exon
upstream ENSMUSE00000197651 Chr6:126794809..126794979 No primer for this exon
upstream ENSMUSE00000197645 Chr6:126794326..126794423 No primer for this exon
upstream ENSMUSE00000197647 Chr6:126792139..126792230 No primer for this exon
upstream ENSMUSE00000240808 Chr6:126790516..126790657 No primer for this exon

*** Putative Vector Insertion (Chr 6: 126786340 - 126790515) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197646 Chr6:126786237..126786339 No primer for this exon
downstream ENSMUSE00000197650 Chr6:126784447..126784514 No primer for this exon
downstream ENSMUSE00000197648 Chr6:126782490..126782566 No primer for this exon
downstream ENSMUSE00000197653 Chr6:126777558..126777653 No primer for this exon
downstream ENSMUSE00000240768 Chr6:126774954..126775020 No primer for this exon
downstream ENSMUSE00000240759 Chr6:126771995..126772207 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr6:126787444..126787464 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGACGTGACTGGGAAAACC Chr6:126790448..126790468 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000399