Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14670
Trapped Gene
2610109H07Rik (ENSMUSG00000029005)
Vector Insertion
Chr 4: 147482043 - 147483821
Public Clones CMHD-GT_540D6-5S (cmhd) FHCRC-GT-S2-11B1 (fhcrc) FHCRC-GT-S2-11C1 (fhcrc)
IST11484C6 (tigm)
Private Clones OST129085 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000184423 (Chr4:147483731..147483820 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGACCATCACCAGGATTG Chr4:147483739..147483758 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000184423 (Chr4:147483731..147483820 -)
Downstram Exon
ENSMUSE00000184427 (Chr4:147482044..147482133 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGACCATCACCAGGATTG Chr4:147483739..147483758 60.38 50 CATGCAGTCGTCGAAACATT Chr4:147482032..147482051 59.72 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447651 Chr4:147504682..147504788 No primer for this exon
upstream ENSMUSE00000447643 Chr4:147489668..147490109 GAAACGTGGCAGAGAACACA Chr4:147489701..147489720 59.88 50
upstream ENSMUSE00000447626 Chr4:147486821..147487014 GGAGGGTACCATGGAGGAGT Chr4:147486928..147486947 60.19 60
upstream ENSMUSE00000447621 Chr4:147484154..147484265 CACACTGGACATGGCCTTATT Chr4:147484213..147484233 59.87 47.62
upstream ENSMUSE00000184423 Chr4:147483731..147483820 TGTGACCATCACCAGGATTG Chr4:147483739..147483758 60.38 50
upstream ENSMUSE00000184427 Chr4:147482044..147482133 No primer for this exon

*** Putative Vector Insertion (Chr 4: 147482043 - 147483821) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184421 Chr4:147472547..147476691 TAAACCGCTCTCCAGCTTGT Chr4:147476393..147476412 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTTGTCCCCAGAGAAACA Chr4:147483812..147483833 59.7 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTTGTCCCCAGAGAAACA Chr4:147483812..147483833 59.7 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAGTAATCGCCTTGCAGCAC Chr4:147483662..147483682 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GATTGCTTGCCAGGTATTCTG Chr4:147483721..147483742 59.72 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029005