Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14671
Trapped Gene
Tbcel (ENSMUSG00000037287)
Vector Insertion
Chr 9: 42259695 - 42269486
Public Clones FHCRC-GT-S2-11A1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000536146 (Chr9:42269357..42269485 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTCGGCGTGGAGACATAG Chr9:42269404..42269423 60.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000536146 (Chr9:42269357..42269485 -)
Downstram Exon
ENSMUSE00000584659 (Chr9:42259696..42259845 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTCGGCGTGGAGACATAG Chr9:42269404..42269423 60.24 55 CTTCTCCCACTAGGCTGGTC Chr9:42259784..42259803 58.89 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411778 Chr9:42280149..42280309 AGAAGGGGTCGAGGTGAAGT Chr9:42280256..42280275 60.11 55
upstream ENSMUSE00000536146 Chr9:42269357..42269485 ATCTCGGCGTGGAGACATAG Chr9:42269404..42269423 60.24 55
upstream ENSMUSE00000584658 Chr9:42259696..42259845 AAGATGGACCAGCCTAGTGG Chr9:42259812..42259831 59.16 55
upstream ENSMUSE00000584659 Chr9:42259696..42259845 AAGATGGACCAGCCTAGTGG Chr9:42259812..42259831 59.16 55

*** Putative Vector Insertion (Chr 9: 42259695 - 42269486) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000403463 Chr9:42258007..42258146 TCGAGTTCTGACACGTGAGC Chr9:42258019..42258038 60.19 55
downstream ENSMUSE00000269012 Chr9:42252490..42252671 CAGAGAAGGACCCAGCACAT Chr9:42252544..42252563 60.26 55
downstream ENSMUSE00000268988 Chr9:42250902..42251158 GACCGCAGATTAGGGAACAA Chr9:42250900..42250919 60.07 50
downstream ENSMUSE00000268968 Chr9:42247180..42247306 CTTCAAGCTTGGGGAATGAA Chr9:42247231..42247250 60.18 45
downstream ENSMUSE00000268947 Chr9:42245198..42245314 CTCACCATCCGTCACAACAC Chr9:42245244..42245263 60.01 55
downstream ENSMUSE00000707268 Chr9:42221501..42224232 TCCACGGGGGACATAAAATA Chr9:42222667..42222686 60.01 45
downstream ENSMUSE00000509751 Chr9:42220400..42224232 TCCACGGGGGACATAAAATA Chr9:42222667..42222686 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTCAGGTAATCGCCTTGC Chr9:42263423..42263443 60.67 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTCGTGACTGGGAAAAC Chr9:42266420..42266440 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037287