Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14672
Trapped Gene
2810403A07Rik (ENSMUSG00000028060)
Vector Insertion
Chr 3: 88493626 - 88496997
Public Clones FHCRC-GT-S2-10F1 (fhcrc) IST10124F12 (tigm) IST10122H6 (tigm) IST10122A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175574 (Chr3:88493546..88493625 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGGTTCATGACGACTGAG Chr3:88493583..88493602 59.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175574 (Chr3:88493546..88493625 +)
Downstram Exon
ENSMUSE00000175578 (Chr3:88496998..88497050 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGGTTCATGACGACTGAG Chr3:88493583..88493602 59.26 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175588 Chr3:88489749..88489809 No primer for this exon
upstream ENSMUSE00000290849 Chr3:88490266..88490488 TGCCAAGATCAATGCTATGC Chr3:88490422..88490441 59.8 45
upstream ENSMUSE00000175585 Chr3:88493097..88493225 CAATGACGTGCCTCTGACAT Chr3:88493168..88493187 59.71 50
upstream ENSMUSE00000175574 Chr3:88493546..88493625 GACGGTTCATGACGACTGAG Chr3:88493583..88493602 59.26 55

*** Putative Vector Insertion (Chr 3: 88493626 - 88496997) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175578 Chr3:88496998..88497050 No primer for this exon
downstream ENSMUSE00000175577 Chr3:88497343..88497506 GGAGCTGGCTGGTGATAGAC Chr3:88497457..88497476 59.83 60
downstream ENSMUSE00000175575 Chr3:88500487..88500698 TGAGCCTTTCCCTCGTAGAA Chr3:88500642..88500661 59.95 50
downstream ENSMUSE00000175581 Chr3:88502771..88502831 ATTCTCGCAGAGCTTCTTGG Chr3:88502822..88502841 59.72 50
downstream ENSMUSE00000175584 Chr3:88503873..88503930 No primer for this exon
downstream ENSMUSE00000175571 Chr3:88504183..88504436 TACTCCGTAGGGAGGCTGAA Chr3:88504313..88504332 59.83 55
downstream ENSMUSE00000175587 Chr3:88512702..88512863 TGTGAATCGCCTCTTCTGTG Chr3:88512821..88512840 59.98 50
downstream ENSMUSE00000175586 Chr3:88513752..88513864 ATCCTGCGCCTTCTATCTCA Chr3:88513824..88513843 59.94 50
downstream ENSMUSE00000175576 Chr3:88514683..88514774 CCAGACCCATTCCTTTCATC Chr3:88514757..88514776 59.34 50
downstream ENSMUSE00000378006 Chr3:88515552..88515751 AATCCCTTCTCTGCCGTTTT Chr3:88515594..88515613 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCATAGTTAATCGCCTTGC Chr3:88493668..88493689 58.87 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATAGTCGTGACTGGGAAAA Chr3:88496670..88496691 59.98 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028060