Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14694
Trapped Gene
Nup188 (ENSMUSG00000052533)
Vector Insertion
Chr 2: 30141991 - 30152167
Public Clones H011B03 (ggtc) D087E03 (ggtc) (ggtc) E083B06 (ggtc) P135A11 (ggtc)
D087G04 (ggtc) (ggtc) FHCRC-GT-S1-2A1 (fhcrc) IST13016F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713746 (Chr2:30141953..30141990 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713746 (Chr2:30141953..30141990 +)
Downstram Exon
ENSMUSE00000344614 (Chr2:30152168..30152222 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCTCCCAAGTAGAATTGTCCAG Chr2:30152205..30152226 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696496 Chr2:30141949..30141990 No primer for this exon
upstream ENSMUSE00000713746 Chr2:30141953..30141990 No primer for this exon
upstream ENSMUSE00000718076 Chr2:30141953..30141990 No primer for this exon

*** Putative Vector Insertion (Chr 2: 30141991 - 30152167) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000344614 Chr2:30152168..30152222 CCTCCCAAGTAGAATTGTCCAG Chr2:30152205..30152226 59.99 50
downstream ENSMUSE00000696487 Chr2:30152168..30152222 CCTCCCAAGTAGAATTGTCCAG Chr2:30152205..30152226 59.99 50
downstream ENSMUSE00000387349 Chr2:30153936..30154009 TTCTAACAACCGCTGCCAAT Chr2:30153986..30154005 60.64 45
downstream ENSMUSE00000696484 Chr2:30153936..30154009 TTCTAACAACCGCTGCCAAT Chr2:30153986..30154005 60.64 45
downstream ENSMUSE00000351998 Chr2:30156320..30156404 GACTCTTAGGCCCAGCTCCT Chr2:30156395..30156414 59.98 60
downstream ENSMUSE00000696480 Chr2:30156320..30156404 GACTCTTAGGCCCAGCTCCT Chr2:30156395..30156414 59.98 60
downstream ENSMUSE00000378656 Chr2:30156529..30156609 CCCGAGTACCCCTGTAATCC Chr2:30156601..30156620 60.57 60
downstream ENSMUSE00000696477 Chr2:30156529..30156609 CCCGAGTACCCCTGTAATCC Chr2:30156601..30156620 60.57 60
downstream ENSMUSE00000450871 Chr2:30157521..30157565 CTGGCTCTGCCTCTCATCTT Chr2:30157553..30157572 59.7 55
downstream ENSMUSE00000696474 Chr2:30157521..30157565 CTGGCTCTGCCTCTCATCTT Chr2:30157553..30157572 59.7 55
downstream ENSMUSE00000696493 Chr2:30159180..30159275 GGTAAGGCATTCCTGAGCTG Chr2:30159232..30159251 59.84 55
downstream ENSMUSE00000284835 Chr2:30159577..30159669 ATGGCGTTCATCTTGGAAAT Chr2:30159663..30159682 59.39 40
downstream ENSMUSE00000696472 Chr2:30159577..30159669 ATGGCGTTCATCTTGGAAAT Chr2:30159663..30159682 59.39 40
downstream ENSMUSE00000284825 Chr2:30159802..30159921 No primer for this exon
downstream ENSMUSE00000696470 Chr2:30159802..30159921 No primer for this exon
downstream ENSMUSE00000284814 Chr2:30163041..30163252 AAACCCTTGCTCCTTGAACA Chr2:30163190..30163209 59.71 45
downstream ENSMUSE00000696468 Chr2:30163041..30163252 AAACCCTTGCTCCTTGAACA Chr2:30163190..30163209 59.71 45
downstream ENSMUSE00000284804 Chr2:30164739..30164853 TCATCCAAGGCGTACTTGTG Chr2:30164810..30164829 59.72 50
downstream ENSMUSE00000696467 Chr2:30164739..30164853 TCATCCAAGGCGTACTTGTG Chr2:30164810..30164829 59.72 50
downstream ENSMUSE00000401623 Chr2:30165398..30165598 TCTTCCTGACCACACTGCTG Chr2:30165521..30165540 60.02 55
downstream ENSMUSE00000696465 Chr2:30165398..30165598 TCTTCCTGACCACACTGCTG Chr2:30165521..30165540 60.02 55
downstream ENSMUSE00000284797 Chr2:30168120..30168209 AGTGTGTGCAGCTCCAGTGA Chr2:30168199..30168218 60.69 55
downstream ENSMUSE00000696463 Chr2:30168120..30168209 AGTGTGTGCAGCTCCAGTGA Chr2:30168199..30168218 60.69 55
downstream ENSMUSE00000284790 Chr2:30170636..30170701 GAACAGCTCTGGAAGGGAAG Chr2:30170695..30170714 59.01 55
downstream ENSMUSE00000696461 Chr2:30170636..30170701 GAACAGCTCTGGAAGGGAAG Chr2:30170695..30170714 59.01 55
downstream ENSMUSE00000351620 Chr2:30172008..30172127 AGAATGATCCCGAGACCAGA Chr2:30172039..30172058 59.61 50
downstream ENSMUSE00000696460 Chr2:30172008..30172127 AGAATGATCCCGAGACCAGA Chr2:30172039..30172058 59.61 50
downstream ENSMUSE00000284715 Chr2:30172701..30172827 ATCATGGGGCTTGTGCTTAT Chr2:30172766..30172785 59.42 45
downstream ENSMUSE00000696459 Chr2:30172701..30172827 ATCATGGGGCTTGTGCTTAT Chr2:30172766..30172785 59.42 45
downstream ENSMUSE00000284709 Chr2:30177402..30177554 AAGAGTACTCCCAGCGGACA Chr2:30177494..30177513 59.87 55
downstream ENSMUSE00000696458 Chr2:30177402..30177554 AAGAGTACTCCCAGCGGACA Chr2:30177494..30177513 59.87 55
downstream ENSMUSE00000284700 Chr2:30177692..30177818 AATCAATGATGGGCTTGACC Chr2:30177736..30177755 59.76 45
downstream ENSMUSE00000696457 Chr2:30177692..30177818 AATCAATGATGGGCTTGACC Chr2:30177736..30177755 59.76 45
downstream ENSMUSE00000284690 Chr2:30178006..30178093 GCAGCCAAGACAGTTAAGCA Chr2:30178080..30178099 59.22 50
downstream ENSMUSE00000696456 Chr2:30178006..30178093 GCAGCCAAGACAGTTAAGCA Chr2:30178080..30178099 59.22 50
downstream ENSMUSE00000284683 Chr2:30178191..30178267 TGTGTGACGAAGATCAGTCCA Chr2:30178216..30178236 60.3 47.62
downstream ENSMUSE00000696453 Chr2:30178191..30178267 TGTGTGACGAAGATCAGTCCA Chr2:30178216..30178236 60.3 47.62
downstream ENSMUSE00000284675 Chr2:30179040..30179154 CATCAGAAGGCTGCCATACC Chr2:30179085..30179104 60.62 55
downstream ENSMUSE00000696452 Chr2:30179040..30179154 CATCAGAAGGCTGCCATACC Chr2:30179085..30179104 60.62 55
downstream ENSMUSE00000284665 Chr2:30180748..30180868 TTGTAGCGCCATTTGTGGTA Chr2:30180845..30180864 60.13 45
downstream ENSMUSE00000696451 Chr2:30180748..30180868 TTGTAGCGCCATTTGTGGTA Chr2:30180845..30180864 60.13 45
downstream ENSMUSE00000284656 Chr2:30180993..30181059 TGGCACAGGTTCAGTATTGC Chr2:30181041..30181060 59.72 50
downstream ENSMUSE00000696450 Chr2:30180993..30181059 TGGCACAGGTTCAGTATTGC Chr2:30181041..30181060 59.72 50
downstream ENSMUSE00000344490 Chr2:30181970..30182098 TGCTAATGACGGTCTGTCCA Chr2:30182046..30182065 60.26 50
downstream ENSMUSE00000696448 Chr2:30181970..30182098 TGCTAATGACGGTCTGTCCA Chr2:30182046..30182065 60.26 50
downstream ENSMUSE00000470054 Chr2:30182968..30183107 AACGCCAGCTTCACTGTCTT Chr2:30183030..30183049 60.06 50
downstream ENSMUSE00000696446 Chr2:30182968..30183107 AACGCCAGCTTCACTGTCTT Chr2:30183030..30183049 60.06 50
downstream ENSMUSE00000472889 Chr2:30184827..30184933 GGCTAGGACAGCAATGAGGT Chr2:30184864..30184883 59.31 55
downstream ENSMUSE00000696445 Chr2:30184827..30184933 GGCTAGGACAGCAATGAGGT Chr2:30184864..30184883 59.31 55
downstream ENSMUSE00000471957 Chr2:30186077..30186283 GCTGTGTCTCTACCGCCACT Chr2:30186227..30186246 60.48 60
downstream ENSMUSE00000696444 Chr2:30186077..30186283 GCTGTGTCTCTACCGCCACT Chr2:30186227..30186246 60.48 60
downstream ENSMUSE00000474783 Chr2:30186367..30186536 ATAGCTGCACGATGCAACAG Chr2:30186476..30186495 60.04 50
downstream ENSMUSE00000696443 Chr2:30186367..30186536 ATAGCTGCACGATGCAACAG Chr2:30186476..30186495 60.04 50
downstream ENSMUSE00000473792 Chr2:30187905..30187974 GTTCCAAACAGCGGACTTGT Chr2:30187949..30187968 60.16 50
downstream ENSMUSE00000696441 Chr2:30187905..30187974 GTTCCAAACAGCGGACTTGT Chr2:30187949..30187968 60.16 50
downstream ENSMUSE00000507307 Chr2:30188340..30188407 TCTTCATGATCAGGGCACAG Chr2:30188379..30188398 59.79 50
downstream ENSMUSE00000696439 Chr2:30188340..30188407 TCTTCATGATCAGGGCACAG Chr2:30188379..30188398 59.79 50
downstream ENSMUSE00000509991 Chr2:30188790..30188985 GCCAAAGACTTGACGTACCC Chr2:30188885..30188904 59.6 55
downstream ENSMUSE00000696438 Chr2:30188790..30188985 GCCAAAGACTTGACGTACCC Chr2:30188885..30188904 59.6 55
downstream ENSMUSE00000509070 Chr2:30191844..30191921 AATGCTTTGGTCCCATCAAG Chr2:30191923..30191942 59.93 45
downstream ENSMUSE00000696437 Chr2:30191844..30191921 AATGCTTTGGTCCCATCAAG Chr2:30191923..30191942 59.93 45
downstream ENSMUSE00000511818 Chr2:30192162..30192247 CCACTGGCGTAGGAGGATAA Chr2:30192245..30192264 60.09 55
downstream ENSMUSE00000696436 Chr2:30192162..30192247 CCACTGGCGTAGGAGGATAA Chr2:30192245..30192264 60.09 55
downstream ENSMUSE00000510877 Chr2:30192452..30192597 TCGCAGCTCCTTCATCTGTA Chr2:30192599..30192618 59.7 50
downstream ENSMUSE00000696435 Chr2:30192452..30192597 TCGCAGCTCCTTCATCTGTA Chr2:30192599..30192618 59.7 50
downstream ENSMUSE00000359163 Chr2:30192744..30192925 CTGTCTCCATGCTGTCCTTG Chr2:30192887..30192906 59.42 55
downstream ENSMUSE00000163634 Chr2:30195019..30195219 AGCTCCTTAGCCAGATGCAG Chr2:30195056..30195075 59.74 55
downstream ENSMUSE00000284610 Chr2:30195336..30195428 ACACTCAAGAGGGGCAAACA Chr2:30195400..30195419 60.69 50
downstream ENSMUSE00000284602 Chr2:30196109..30196267 GCCTCCGTCAGGAAATTGTA Chr2:30196230..30196249 60.07 50
downstream ENSMUSE00000284545 Chr2:30197212..30197349 ACGGTGTGATCTGCTTCCTC Chr2:30197276..30197295 60.27 55
downstream ENSMUSE00000284540 Chr2:30197893..30197967 ACAGGCCTGGCACAAGTAAC Chr2:30197925..30197944 60.18 55
downstream ENSMUSE00000410273 Chr2:30198053..30198310 AGACATCCGGAGTGAAGTGG Chr2:30198293..30198312 60.11 55
downstream ENSMUSE00000284529 Chr2:30198442..30198573 GGGAGCCACTTCAGAGTCAA Chr2:30198522..30198541 60.39 55
downstream ENSMUSE00000696434 Chr2:30198483..30198494 No primer for this exon
downstream ENSMUSE00000284523 Chr2:30198795..30198868 TAATGTTCGGGTCCCTTCTG Chr2:30198869..30198888 59.93 50
downstream ENSMUSE00000284519 Chr2:30198981..30199110 GCTTGGGAGATGAGCAGGTA Chr2:30199037..30199056 60.36 55
downstream ENSMUSE00000387211 Chr2:30199222..30199782 TGCACAAGTTGGATCAGAGG Chr2:30199373..30199392 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCAGGGATCCTTTCTTGTTT Chr2:30147975..30147996 59.93 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGGGATCCTTTCTTGTTT Chr2:30147975..30147996 59.93 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052533