Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14695
Trapped Gene
D930028M14Rik (ENSMUSG00000074274)
Vector Insertion
Chr 7: 25937646 - 25940340
Public Clones CMHD-GT_537A6-5S (cmhd) CMHD-GT_537A6-3 (cmhd) FHCRC-GT-UAS-2G10 (fhcrc) IST14345G7 (tigm)
IST14734B11 (tigm) IST13057A10 (tigm) IST13767G7 (tigm)
Private Clones OST273817 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636465 (Chr7:25937476..25937645 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCACCCCATACTCCCCTA Chr7:25937577..25937596 59.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636465 (Chr7:25937476..25937645 +)
Downstram Exon
ENSMUSE00000636464 (Chr7:25940341..25940639 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCACCCCATACTCCCCTA Chr7:25937577..25937596 59.62 55 AGAGCTCTGATCCGCAACAT Chr7:25940567..25940586 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636465 Chr7:25937476..25937645 CATCACCCCATACTCCCCTA Chr7:25937577..25937596 59.62 55

*** Putative Vector Insertion (Chr 7: 25937646 - 25940340) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636464 Chr7:25940341..25940639 AGAGCTCTGATCCGCAACAT Chr7:25940567..25940586 59.98 50
downstream ENSMUSE00000636463 Chr7:25941113..25941642 ATCGCTGGGTCTAAGGAGGT Chr7:25941182..25941201 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr7:25937696..25937716 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACATCCGTGACTGGGAAAA Chr7:25937691..25937711 61.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074274