Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14696
Trapped Gene
Zfand6 (ENSMUSG00000030629)
Vector Insertion
Chr 7: 91782748 - 91827901
Public Clones (sanger) (sanger) D026C02 (ggtc) E120A09 (ggtc) 3SE142A03 (ggtc)
D026C02 (ggtc) D032C08 (ggtc) (ggtc) FHCRC-GT-S1-1G1 (fhcrc) IST10035B4 (tigm)
IST14182C8 (tigm) IST15000B11 (tigm) IST14989B4 (tigm)
Private Clones OST464603 (lexicon) OST455559 (lexicon) OST449209 (lexicon) OST427669 (lexicon)
OST423834 (lexicon) OST410528 (lexicon) OST376923 (lexicon) OST373946 (lexicon)
OST367632 (lexicon) OST367494 (lexicon) OST364440 (lexicon) OST311863 (lexicon)
OST293500 (lexicon) OST275673 (lexicon) OST240596 (lexicon) OST233383 (lexicon)
OST224747 (lexicon) OST215570 (lexicon) OST213596 (lexicon) OST185516 (lexicon)
OST179825 (lexicon) OST172905 (lexicon) OST171359 (lexicon) OST171129 (lexicon)
OST155996 (lexicon) OST134930 (lexicon) OST132580 (lexicon) OST104652 (lexicon)
OST103536 (lexicon) OST103526 (lexicon) OST102958 (lexicon) OST102717 (lexicon)
OST102220 (lexicon) OST101164 (lexicon) OST86126 (lexicon) OST75593 (lexicon)
OST74988 (lexicon) OST72971 (lexicon) OST68604 (lexicon) OST65273 (lexicon)
OST36016 (lexicon) OST34256 (lexicon) OST33511 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000448001 (Chr7:91827820..91827900 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGTTTGGTTGCTTTGGAG Chr7:91827881..91827900 60.66 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000448001 (Chr7:91827820..91827900 -)
Downstram Exon
ENSMUSE00000201418 (Chr7:91782749..91782919 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGTTTGGTTGCTTTGGAG Chr7:91827881..91827900 60.66 50 TGCCATTTGTACGAGGGTTT Chr7:91782796..91782815 60.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448001 Chr7:91827820..91827900 CAGGTTTGGTTGCTTTGGAG Chr7:91827881..91827900 60.66 50
upstream ENSMUSE00000201418 Chr7:91782749..91782919 GCTGCGGATTTTATGGAAAC Chr7:91782834..91782853 59.55 45

*** Putative Vector Insertion (Chr 7: 91782748 - 91827901) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000201419 Chr7:91782395..91782503 CATCTGCGCACTGTACTGGT Chr7:91782431..91782450 59.93 55
downstream ENSMUSE00000201420 Chr7:91781166..91781266 ACTGTCCACTTGGGAAGGTG Chr7:91781187..91781206 60 55
downstream ENSMUSE00000201414 Chr7:91769378..91769422 No primer for this exon
downstream ENSMUSE00000201415 Chr7:91766360..91766473 GGCTGCTGTGTCGTATCTGA Chr7:91766424..91766443 60.02 55
downstream ENSMUSE00000201416 Chr7:91763564..91764478 ATCAAAAGGGAATCGTGCTG Chr7:91763920..91763939 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAATTGGGATGGGAGAAAA Chr7:91800866..91800886 60.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr7:91800834..91800854 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGCAAAGATTATCCCCTCAA Chr7:91800847..91800868 59.53 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGATTGCAACTCCTCTGTTGA Chr7:91800779..91800801 60.3 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030629