Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1470
Trapped Gene
Dennd1b (ENSMUSG00000056268)
Vector Insertion
Chr 1: 141040578 - 141064247
Public Clones CD0442 (sanger) RRF437 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454796 (Chr1:141040470..141040577 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACCTGTTCTGGTTTGGTG Chr1:141040489..141040508 60.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454796 (Chr1:141040470..141040577 +)
Downstram Exon
ENSMUSE00000454794 (Chr1:141064248..141064333 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACCTGTTCTGGTTTGGTG Chr1:141040489..141040508 60.4 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459899 Chr1:140860363..140860462 No primer for this exon
upstream ENSMUSE00000459874 Chr1:140862743..140862807 No primer for this exon
upstream ENSMUSE00000690162 Chr1:140864298..140864405 CCAGGGACGTCTTCATTTGT Chr1:140864333..140864352 59.97 50
upstream ENSMUSE00000538564 Chr1:140919682..140919725 CCAGAGGACTTTGGAGACCA Chr1:140919705..140919724 60.23 55
upstream ENSMUSE00000595826 Chr1:140919682..140919725 CCAGAGGACTTTGGAGACCA Chr1:140919705..140919724 60.23 55
upstream ENSMUSE00000538562 Chr1:140936577..140936626 GTGCCCAAGTTCTGTTTTCC Chr1:140936592..140936611 59.57 50
upstream ENSMUSE00000595825 Chr1:140936577..140936626 GTGCCCAAGTTCTGTTTTCC Chr1:140936592..140936611 59.57 50
upstream ENSMUSE00000459856 Chr1:140938501..140938620 TAAGCAGCGATTTGGGTTCT Chr1:140938558..140938577 59.85 45
upstream ENSMUSE00000595824 Chr1:140938501..140938620 TAAGCAGCGATTTGGGTTCT Chr1:140938558..140938577 59.85 45
upstream ENSMUSE00000659186 Chr1:140949923..140949992 No primer for this exon
upstream ENSMUSE00000659185 Chr1:140951118..140951198 CCCAGTACCAAAGGCAAACA Chr1:140951159..140951178 60.91 50
upstream ENSMUSE00000459838 Chr1:140955644..140955703 TTGCCAGTGAGCAAGTTCTG Chr1:140955660..140955679 60.17 50
upstream ENSMUSE00000659184 Chr1:140956852..140956905 No primer for this exon
upstream ENSMUSE00000459892 Chr1:140959438..140960290 GTCAACAACATGCTGCGACT Chr1:140959471..140959490 59.91 50
upstream ENSMUSE00000595820 Chr1:140959438..140959548 GTCAACAACATGCTGCGACT Chr1:140959471..140959490 59.91 50
upstream ENSMUSE00000595819 Chr1:140977750..140977850 GATCGGCTGCGCTACTCTAC Chr1:140977769..140977788 60.15 60
upstream ENSMUSE00000595818 Chr1:140982460..140982505 CCCAATGCCATACCTGATTG Chr1:140982463..140982482 61.11 50
upstream ENSMUSE00000595817 Chr1:140987031..140987132 No primer for this exon
upstream ENSMUSE00000595816 Chr1:140998545..140998670 GTTTGGCTCCTACCGAGATG Chr1:140998634..140998653 59.69 55
upstream ENSMUSE00000595815 Chr1:141006961..141007062 TTTGTAAAGCACCGCTCAAG Chr1:141006991..141007010 59.11 45
upstream ENSMUSE00000483572 Chr1:141018444..141018660 No primer for this exon
upstream ENSMUSE00000454816 Chr1:141022654..141022724 AATGTTTGCCTGGAGTTTCC Chr1:141022685..141022704 59.03 45
upstream ENSMUSE00000454811 Chr1:141030248..141030338 GCAAAGCTTAACGCAGGAAG Chr1:141030266..141030285 60.15 50
upstream ENSMUSE00000454806 Chr1:141035958..141035998 CCCGAGGTCATATCAGCAGT Chr1:141035962..141035981 60.1 55
upstream ENSMUSE00000454803 Chr1:141037029..141037097 TGTGCGGACTGCATACAAAT Chr1:141037076..141037095 60.14 45
upstream ENSMUSE00000538550 Chr1:141039411..141039467 ACGCCAGACTGGGACTAAAG Chr1:141039421..141039440 59.35 55
upstream ENSMUSE00000454796 Chr1:141040470..141040577 GGACCTGTTCTGGTTTGGTG Chr1:141040489..141040508 60.4 55

*** Putative Vector Insertion (Chr 1: 141040578 - 141064247) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000454794 Chr1:141064248..141064333 No primer for this exon
downstream ENSMUSE00000454790 Chr1:141065409..141065625 ACGGAGTCATCGCTTTCGTA Chr1:141065471..141065490 60.8 50
downstream ENSMUSE00000454824 Chr1:141066333..141068489 GTTTTACGCTGGGAAACCAA Chr1:141067058..141067077 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGTTTTAATCGCCTTGCAG Chr1:141046622..141046643 59.9 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTCGTGACTGGGAAAACC Chr1:141046625..141046645 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056268