Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14704
Trapped Gene
Rabep2 (ENSMUSG00000030727)
Vector Insertion
Chr 7: 133573300 - 133579173
Public Clones (ggtc) PST15483-NR (escells) PST10292-NR (escells) PST15355-NR (escells)
PST13717-NL (escells)
Private Clones OST385916 (lexicon) OST106731 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669821 (Chr7:133572954..133573299 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTTAGGAGATCGGCAAGC Chr7:133573020..133573039 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669821 (Chr7:133572954..133573299 +)
Downstram Exon
ENSMUSE00000202376 (Chr7:133579174..133579331 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTTAGGAGATCGGCAAGC Chr7:133573020..133573039 59.84 55 TCAAAGTCCTGCTGTTGCTG Chr7:133579249..133579268 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710191 Chr7:133572580..133572670 No primer for this exon
upstream ENSMUSE00000717178 Chr7:133572580..133572670 No primer for this exon
upstream ENSMUSE00000669821 Chr7:133572954..133573299 GTGTTAGGAGATCGGCAAGC Chr7:133573020..133573039 59.84 55
upstream ENSMUSE00000509226 Chr7:133573090..133573299 AAGTGAGCTCAGTCGGCTTC Chr7:133573136..133573155 59.75 55
upstream ENSMUSE00000669825 Chr7:133573090..133573299 AAGTGAGCTCAGTCGGCTTC Chr7:133573136..133573155 59.75 55

*** Putative Vector Insertion (Chr 7: 133573300 - 133579173) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000202376 Chr7:133579174..133579331 TCAAAGTCCTGCTGTTGCTG Chr7:133579249..133579268 60.17 50
downstream ENSMUSE00000202380 Chr7:133581884..133581994 TCTCGAAGCTTTTCCGAGTC Chr7:133581915..133581934 59.69 50
downstream ENSMUSE00000202372 Chr7:133582076..133582420 AGAGGGAGCAACTCTGTGGA Chr7:133582131..133582150 59.99 55
downstream ENSMUSE00000202387 Chr7:133583680..133583775 TGGCACAGTCTTCATTGCTC Chr7:133583773..133583792 59.99 50
downstream ENSMUSE00000202373 Chr7:133583862..133583960 TGCTCTGAGTTCTGGACCTG Chr7:133583902..133583921 59.12 55
downstream ENSMUSE00000202369 Chr7:133585351..133585506 CTCTTGGCTCAGGCACTTGT Chr7:133585392..133585411 60.59 55
downstream ENSMUSE00000202377 Chr7:133587644..133587821 TGTTGCCTGGTATTCTGCAC Chr7:133587681..133587700 59.72 50
downstream ENSMUSE00000632488 Chr7:133587932..133587943 No primer for this exon
downstream ENSMUSE00000202383 Chr7:133588037..133588092 ACCCGCTCCGTCTCTATTCT Chr7:133588076..133588095 60.23 55
downstream ENSMUSE00000202389 Chr7:133588334..133588450 CTGAGAGGAGATCCGTGAGC Chr7:133588361..133588380 60.1 60
downstream ENSMUSE00000493721 Chr7:133588811..133589414 CAGCTGATGGGACTCCAGTT Chr7:133589016..133589035 60.26 55
downstream ENSMUSE00000669820 Chr7:133588811..133589415 CAGCTGATGGGACTCCAGTT Chr7:133589016..133589035 60.26 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTAATCGCCTTGCAGCAC Chr7:133573348..133573368 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTCGTGACTGGGAAAAC Chr7:133573346..133573366 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030727