Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14706
Trapped Gene
Zmat3 (ENSMUSG00000027663)
Vector Insertion
Chr 3: 32259811 - 32264588
Public Clones (sanger) (sanger) (sanger) (sanger) 5SE041E04 (ggtc) (ggtc)
PST15471-NR (escells) IST14921H5 (tigm) IST14452C4 (tigm) IST14148D3 (tigm)
IST14976F3 (tigm) IST14417E8 (tigm) IST13337A6 (tigm) IST13337A8 (tigm)
IST10324H5 (tigm) IST14161G3 (tigm) IST11469H8 (tigm) IST14582E7 (tigm)
IST14422G1 (tigm) IST14988H6 (tigm)
Private Clones OST438349 (lexicon) OST243731 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676063 (Chr3:32264426..32264587 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGACCGACTTTTGACAATCA Chr3:32264532..32264551 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676063 (Chr3:32264426..32264587 -)
Downstram Exon
ENSMUSE00000273004 (Chr3:32259812..32260138 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGACCGACTTTTGACAATCA Chr3:32264532..32264551 59.69 45 AGGTTGAAGGCCGATTAGGT Chr3:32260008..32260027 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676063 Chr3:32264426..32264587 CGACCGACTTTTGACAATCA Chr3:32264532..32264551 59.69 45
upstream ENSMUSE00000273004 Chr3:32259812..32260138 ACCTAATCGGCCTTCAACCT Chr3:32260030..32260049 59.96 50

*** Putative Vector Insertion (Chr 3: 32259811 - 32264588) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171896 Chr3:32244380..32244502 GGACAGCTGTTAGCTGCGTA Chr3:32244428..32244447 59.25 55
downstream ENSMUSE00000171893 Chr3:32242474..32242640 GGAGTCTCTTGGCATGGTTC Chr3:32242483..32242502 59.66 55
downstream ENSMUSE00000171898 Chr3:32242256..32242356 ACTCCCTTCTTTCCGAGTCC Chr3:32242289..32242308 59.68 55
downstream ENSMUSE00000592911 Chr3:32233714..32240617 CGCCTACACGTCCCTAACAT Chr3:32238201..32238220 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCACTTCCTGCAGCTGTTTC Chr3:32264565..32264586 60.05 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCACTTCCTGCAGCTGTTTC Chr3:32264565..32264586 60.05 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTCTGCCTTCCAGAACCAC Chr3:32261454..32261474 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGTCAGCGTGACTGGGAAA Chr3:32261361..32261381 62.29 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027663