Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14707
Trapped Gene
Wipi2 (ENSMUSG00000029578)
Vector Insertion
Chr 5: 143142206 - 143142813
Public Clones CMHD-GT_455D9-3 (cmhd) PST15439-NR (escells) PST8777-NR (escells) PST15414-NL (escells)
PST8083-NR (escells) PST14981-NR (escells) PST15429-NL (escells) PST11575-NR (escells)
PST15413-NR (escells) PST4522-NL (escells) PST15470-NL (escells) PST4522-NR (escells)
PST15423-NR (escells) PST8480-NL (escells) PST15409-NR (escells) PST1434-1 (escells)
PSTVU01.K19 (vanderbilt) IST14887C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000237090 (Chr5:143142048..143142205 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACACAGACGTACGGCACAG Chr5:143142114..143142133 59.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000237090 (Chr5:143142048..143142205 +)
Downstram Exon
ENSMUSE00000685354 (Chr5:143142814..143143441 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACACAGACGTACGGCACAG Chr5:143142114..143142133 59.82 55 TGTTCGCTGTCTTCATCCAG Chr5:143142901..143142920 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000534526 Chr5:143105547..143105786 GATCCTGAGTGTAGCGTGCTC Chr5:143105620..143105640 60.03 57.14
upstream ENSMUSE00000685373 Chr5:143105564..143105786 GATCCTGAGTGTAGCGTGCTC Chr5:143105620..143105640 60.03 57.14
upstream ENSMUSE00000190267 Chr5:143114156..143114238 TCTGTGGATAAGCTGGAACAGA Chr5:143114205..143114226 59.88 45.46
upstream ENSMUSE00000237147 Chr5:143131802..143131971 TATCCTGGCTGTGAAGCTGA Chr5:143131944..143131963 59.55 50
upstream ENSMUSE00000237136 Chr5:143134146..143134242 ACATCCGGGACATGAAGGTA Chr5:143134186..143134205 60.19 50
upstream ENSMUSE00000190265 Chr5:143135019..143135116 GAGGTGCAGGTCTTCGACAC Chr5:143135087..143135106 60.87 60
upstream ENSMUSE00000190261 Chr5:143135487..143135579 AAGCTTGCCACTGCTTCTGA Chr5:143135556..143135575 61.26 50
upstream ENSMUSE00000190271 Chr5:143136979..143137049 TGATTCGGGTGTTTTCCATT Chr5:143136986..143137005 60.17 40
upstream ENSMUSE00000190264 Chr5:143138989..143139096 ACACCGAAACAGTGCACATC Chr5:143139051..143139070 59.6 50
upstream ENSMUSE00000345837 Chr5:143140279..143140443 CACCACCTGGACTGGCTACT Chr5:143140294..143140313 60.17 60
upstream ENSMUSE00000190262 Chr5:143141377..143141484 TTCAGAAGATCCCACGGTTG Chr5:143141379..143141398 61.03 50
upstream ENSMUSE00000237090 Chr5:143142048..143142205 AACACAGACGTACGGCACAG Chr5:143142114..143142133 59.82 55
upstream ENSMUSE00000685355 Chr5:143142048..143142145 AACACAGACGTACGGCACAG Chr5:143142114..143142133 59.82 55

*** Putative Vector Insertion (Chr 5: 143142206 - 143142813) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000190269 Chr5:143142814..143143488 TGTTCGCTGTCTTCATCCAG Chr5:143142901..143142920 59.98 50
downstream ENSMUSE00000685354 Chr5:143142814..143143441 TGTTCGCTGTCTTCATCCAG Chr5:143142901..143142920 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGACGCCAACTTAGAAGG Chr5:143142188..143142208 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGACGCCAACTTAGAAGG Chr5:143142188..143142208 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029578