Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14715
Trapped Gene
Zbed3 (ENSMUSG00000041995)
Vector Insertion
Chr 13: 96095300 - 96106010
Public Clones PST15379-NR (escells) IST14340A9 (tigm) IST12460B5 (tigm) IST10364C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640595 (Chr13:96095256..96095299 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640595 (Chr13:96095256..96095299 +)
Downstram Exon
ENSMUSE00000341342 (Chr13:96106011..96107796 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGCGGTCAGTCATGCTACA Chr13:96106729..96106748 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640595 Chr13:96095256..96095299 No primer for this exon

*** Putative Vector Insertion (Chr 13: 96095300 - 96106010) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000341342 Chr13:96106011..96107796 GAGCGGTCAGTCATGCTACA Chr13:96106729..96106748 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCTCTGAAATTGGACTCA Chr13:96095281..96095301 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTCTGAAATTGGACTCA Chr13:96098281..96098301 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041995