Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14722
Trapped Gene
AC160147.6 (ENSMUSG00000061983)
Vector Insertion
Chr 10: 23506799 - 23507006
Public Clones PST15329-NL (escells) PST15548-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000416964 (Chr10:23506962..23507005 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000416964 (Chr10:23506962..23507005 -)
Downstram Exon
ENSMUSE00000461522 (Chr10:23506800..23506850 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGTGACGCCGAATCTTGAAC Chr10:23506806..23506825 62.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416964 Chr10:23506962..23507005 No primer for this exon
upstream ENSMUSE00000461522 Chr10:23506800..23506850 No primer for this exon

*** Putative Vector Insertion (Chr 10: 23506799 - 23507006) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000467687 Chr10:23506570..23506686 TGACGTCCATTACACCTCCA Chr10:23506636..23506655 59.96 50
downstream ENSMUSE00000469732 Chr10:23505708..23505810 GCCTCCACCAGCTTGACATA Chr10:23505720..23505739 61.21 55
downstream ENSMUSE00000510690 Chr10:23505382..23505483 TGCCCTCTCGATCGATTTTA Chr10:23505401..23505420 60.68 45
downstream ENSMUSE00000409210 Chr10:23505003..23505079 GATGACATCCTTGGCCTGAG Chr10:23505022..23505041 60.62 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGCTCGGGGTGAGTAAT Chr10:23506951..23506971 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCGCTTAAATACCGTCAT Chr10:23507020..23507041 60.47 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061983