Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14739
Trapped Gene
Sfrs1 (ENSMUSG00000018379)
Vector Insertion
Chr 11: 87862177 - 87862544
Public Clones (sanger) P127A07 (ggtc) P127A07 (ggtc) PST14642-NR (escells) PST13574-NR (escells)
PST9893-NR (escells) PST11168-NR (escells) PST8576-NR (escells) PST4323-NR (escells)
PST15186-NR (escells) PST13323-NR (escells) PST13265-NR (escells) PST11212-NR (escells)
PST6796-NR (escells) PST3722-NR (escells) PST1042-2 (escells) PST14713-NR (escells)
PST14036-NR (escells) PST11784-NR (escells) PST10720-NR (escells) PST6778-NR (escells)
PST3123-NR (escells) PST773 (escells) PST13444-NR (escells) PST9671-NR (escells)
PST10805-NR (escells) PST6215-NR (escells) PST4853-NR (escells) PST15033-NR (escells)
PST11749-NR (escells) PST12510-NR (escells) PST11030-NR (escells) PST6790-NR (escells)
PST2421-NR (escells) PST14674-NR (escells) PST13612-NR (escells) PST11759-NR (escells)
PST11103-NR (escells) PST8745-NR (escells) PST2305-NR (escells) PST2785-NR (escells)
PST13422-NR (escells) PST4365-NR (escells) PST984-2 (escells) PST4434-NR (escells)
PST1562-1 (escells) PST14760-NR (escells) PST13933-NR (escells) PST11796-NR (escells)
PST9626-NR (escells) PST6786-NR (escells) PST2287-NR (escells) PSTVU01.HM5 (vanderbilt)
IST10477D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361135 (Chr11:87861992..87862176 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361135 (Chr11:87861992..87862176 +)
Downstram Exon
ENSMUSE00000489619 (Chr11:87862545..87862717 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486255 Chr11:87861173..87861534 No primer for this exon
upstream ENSMUSE00000705979 Chr11:87861187..87861534 No primer for this exon
upstream ENSMUSE00000361135 Chr11:87861992..87862176 No primer for this exon

*** Putative Vector Insertion (Chr 11: 87862177 - 87862544) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000489619 Chr11:87862545..87862717 No primer for this exon
downstream ENSMUSE00000674824 Chr11:87862545..87867259 No primer for this exon
downstream ENSMUSE00000379220 Chr11:87862914..87865110 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCCGAGAACAGAGTGGTT Chr11:87862151..87862171 59.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACTGCTTTGCGTGACTG Chr11:87862216..87862236 60.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018379