Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14745
Trapped Gene
Nono (ENSMUSG00000031311)
Vector Insertion
Chr X: 98632717 - 98634825
Public Clones PST11424-NR (escells) PST14955-NR (escells) PST8580-NR (escells) PST175-3 (escells)
PST2501-NR (escells) PST6243-NR (escells) PST14687-NR (escells) PST3004-NL (escells)
PST11721-NR (escells) PST587-1 (escells) PST1597-1 (escells) PST6243-NL (escells)
PST3956-NR (escells) IST10511G12 (tigm) IST10511G12 (tigm)
Private Clones OST196999 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208229 (ChrX:98632548..98632716 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAAGCATCATCAGCATCA ChrX:98632605..98632624 59.35 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208229 (ChrX:98632548..98632716 +)
Downstram Exon
ENSMUSE00000208220 (ChrX:98634826..98635019 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAAGCATCATCAGCATCA ChrX:98632605..98632624 59.35 45 CAAGCGAATAAAGCCAAAGC ChrX:98635022..98635041 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406395 ChrX:98625028..98625101 CCCATACTCCGAGCAAAGAA ChrX:98625069..98625088 60.21 50
upstream ENSMUSE00000208224 ChrX:98625832..98625891 GACTGCGAGGCAGACACTTT ChrX:98625849..98625868 60.6 55
upstream ENSMUSE00000208229 ChrX:98632548..98632716 AGGAAGCATCATCAGCATCA ChrX:98632605..98632624 59.35 45

*** Putative Vector Insertion (Chr X: 98632717 - 98634825) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000208220 ChrX:98634826..98635019 CAAGCGAATAAAGCCAAAGC ChrX:98635022..98635041 59.99 45
downstream ENSMUSE00000287293 ChrX:98636855..98637156 CTTCCTCGGTCATCCACAAT ChrX:98637066..98637085 59.93 50
downstream ENSMUSE00000549050 ChrX:98638269..98638364 ACTGGTCCATAGGCTCCACA ChrX:98638309..98638328 60.53 55
downstream ENSMUSE00000549049 ChrX:98638634..98638830 TGATGTTCCGATCCACTTGA ChrX:98638758..98638777 60.05 45
downstream ENSMUSE00000549048 ChrX:98639616..98639700 CTGCTTTCGCTTCTGAACCT ChrX:98639692..98639711 59.76 50
downstream ENSMUSE00000549046 ChrX:98640027..98640129 GGTTCCCTTGAATCCTTCCT ChrX:98640120..98640139 59.37 50
downstream ENSMUSE00000549044 ChrX:98640634..98640673 GCCCATCCGTATCTCTTGTT ChrX:98640660..98640679 59.01 50
downstream ENSMUSE00000549043 ChrX:98641458..98641567 CAATCCAAGGGTTCCATCTG ChrX:98641570..98641589 60.31 50
downstream ENSMUSE00000372980 ChrX:98642933..98643929 GGCCAAAACGTTCAGTTGTT ChrX:98642963..98642982 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCCCCTGGGAATTAATCG ChrX:98632754..98632774 60.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACCAATACCTGCAAATGG ChrX:98632678..98632698 61.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031311