Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14752
Trapped Gene
Ube2m (ENSMUSG00000005575)
Vector Insertion
Chr 7: 13621914 - 13623328
Public Clones (ggtc) (ggtc) PST14516-NR (escells) PST10550-NR (escells) PST5926-NR (escells)
PST11282-NR (escells) PST11206-NR (escells) PST12024-NR (escells) PST8749-NR (escells)
PST14673-NR (escells) PST10803-NR (escells) PST1752-NR (escells) PST9305-NR (escells)
PST6789-NR (escells) PST10286-NR (escells) PST6058-NR (escells) PST1203-NR (escells)
PST10591-NR (escells) PST5287-NR (escells) PST2174-NR (escells) PST6780-NR (escells)
PSTVU01.HN1 (vanderbilt) PSTVU01.HL22 (vanderbilt) IST14147H2 (tigm)
Private Clones OST402680 (lexicon) OST328689 (lexicon) OST317701 (lexicon) OST269704 (lexicon)
OST96565 (lexicon) OST35870 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000365033 (Chr7:13622970..13623327 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000365033 (Chr7:13622970..13623327 -)
Downstram Exon
ENSMUSE00000286070 (Chr7:13621915..13622009 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000365033 Chr7:13622970..13623327 No primer for this exon
upstream ENSMUSE00000286070 Chr7:13621915..13622009 No primer for this exon

*** Putative Vector Insertion (Chr 7: 13621914 - 13623328) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000195441 Chr7:13621783..13621821 No primer for this exon
downstream ENSMUSE00000195443 Chr7:13621561..13621664 No primer for this exon
downstream ENSMUSE00000481905 Chr7:13621191..13621254 No primer for this exon
downstream ENSMUSE00000408154 Chr7:13620588..13621103 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACACACCCGAGGTGCTAAT Chr7:13623273..13623293 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTGGCGAGAAAATGTAAT Chr7:13622914..13622934 59.96 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 AAAATGCGTGACTGGGAAAA Chr7:13622904..13622924 60.48 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005575