Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14762
Trapped Gene
Lhfpl4 (ENSMUSG00000042873)
Vector Insertion
Chr 6: 112964404 - 113121953
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) P143B11 (ggtc) P137E02 (ggtc)
P104H04 (ggtc) E043H08 (ggtc) D043G11 (ggtc) 5SE306G09 (ggtc) (ggtc)
P140H08 (ggtc) P126E01 (ggtc) H010F03 (ggtc) E038H01 (ggtc) D038F10 (ggtc)
3SE386E10 (ggtc) P150A09 (ggtc) P140C07 (ggtc) P105C01 (ggtc) H001A04 (ggtc)
D045E10 (ggtc) D016C03 (ggtc) P142F10 (ggtc) P128G06 (ggtc) P104H04 (ggtc)
E041E05 (ggtc) D042C07 (ggtc) 3SE306G09 (ggtc) P140H08 (ggtc) P119C07 (ggtc)
H010F03 (ggtc) D146E11 (ggtc) D016F06 (ggtc) P150A09 (ggtc) P140C07 (ggtc)
P105C01 (ggtc) H001A04 (ggtc) D045E10 (ggtc) (ggtc) P142F10 (ggtc)
P128G06 (ggtc) P100H03 (ggtc) E041E05 (ggtc) D042C07 (ggtc) 5SE386E10 (ggtc)
P140C10 (ggtc) P119C07 (ggtc) H006H07 (ggtc) D045G12 (ggtc) D016F06 (ggtc)
CMHD-GT_521B6-5S (cmhd) CMHD-GT_517B6-5S (cmhd) PST7809-NL (escells) PST4303-NL (escells)
PST8640-NR (escells) PST8600-NL (escells) PST23470-NL (escells) PST15562-NL (escells)
PST6885-NR (escells) PST14810-NL (escells) PST217-1 (escells) PST8085-NL (escells)
PST14487-NR (escells) PST9555-NR (escells) PST10823-NL (escells) PSTVU01.H22D (vanderbilt)
IST14411E8 (tigm) IST14808C5 (tigm) IST11435D7 (tigm) IST14636G6 (tigm)
IST10081D11 (tigm) IST11435D7 (tigm) IST13130A10 (tigm) IST14922D8 (tigm)
IST12986H4 (tigm) IST12520D3 (tigm) IST14720D8 (tigm) IST14922C9 (tigm)
IST14808C5 (tigm) IST12937G7 (tigm) IST14534B1 (tigm) IST12937G7 (tigm)
IST14804D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000392327 (Chr6:113120436..113121952 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCTTGGAGCTGAGGTAGG Chr6:113120779..113120798 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000392327 (Chr6:113120436..113121952 -)
Downstram Exon
ENSMUSE00000612884 (Chr6:112964405..112964445 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCTTGGAGCTGAGGTAGG Chr6:113120779..113120798 60.01 60 TCTTTGTGTGTGTGCGTGTG Chr6:112964385..112964404 60.41 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612886 Chr6:113145209..113145325 CAACCGCTGTTAGGAGCATC Chr6:113145265..113145284 60.8 55
upstream ENSMUSE00000349559 Chr6:113143812..113144297 GGCTCTTTCACCGACTTCAG Chr6:113143964..113143983 59.99 55
upstream ENSMUSE00000348851 Chr6:113126440..113126676 AGTACTCCCTGGGGGACTGT Chr6:113126570..113126589 59.85 60
upstream ENSMUSE00000392327 Chr6:113120436..113121952 GTGCTTGGAGCTGAGGTAGG Chr6:113120779..113120798 60.01 60
upstream ENSMUSE00000612884 Chr6:112964405..112964445 ACATACGCACACGCACACAC Chr6:112964414..112964433 61.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGTGTGGTAAACATTCA Chr6:112998913..112998933 59.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAAGATCGTGACTGGGAAA Chr6:112971889..112971910 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042873