Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14763
Trapped Gene
Srcap (ENSMUSG00000053877)
Vector Insertion
Chr 7: 134659716 - 134663094
Public Clones (sanger) D004B03 (ggtc) D004B03 (ggtc) PST15527-NR (escells) IST11636C12 (tigm)
IST14229G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708270 (Chr7:134659456..134659715 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAACGGTGATAACCCAGTC Chr7:134659603..134659622 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708270 (Chr7:134659456..134659715 +)
Downstram Exon
ENSMUSE00000669352 (Chr7:134663095..134663116 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAACGGTGATAACCCAGTC Chr7:134659603..134659622 60.38 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000632358 Chr7:134655516..134655852 GGTAGCGATAACGAGCCTTG Chr7:134655541..134655560 59.87 55
upstream ENSMUSE00000434975 Chr7:134657679..134657754 AGACTCTCACAGGGGGTGTG Chr7:134657719..134657738 60.15 60
upstream ENSMUSE00000708270 Chr7:134659456..134659715 GCAACGGTGATAACCCAGTC Chr7:134659603..134659622 60.38 55
upstream ENSMUSE00000715889 Chr7:134659456..134659715 GCAACGGTGATAACCCAGTC Chr7:134659603..134659622 60.38 55
upstream ENSMUSE00000705496 Chr7:134659662..134659715 CCTCAGCTCCCAATCCTACA Chr7:134659689..134659708 60.21 55

*** Putative Vector Insertion (Chr 7: 134659716 - 134663094) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434971 Chr7:134663095..134663346 TCCTGCCCCACTAGAATCTG Chr7:134663175..134663194 60.21 55
downstream ENSMUSE00000669344 Chr7:134663095..134663346 TCCTGCCCCACTAGAATCTG Chr7:134663175..134663194 60.21 55
downstream ENSMUSE00000669352 Chr7:134663095..134663116 No primer for this exon
downstream ENSMUSE00000632356 Chr7:134663171..134663346 AACCCCTCCAGAGGAACTGT Chr7:134663264..134663283 59.97 55
downstream ENSMUSE00000434965 Chr7:134664990..134665076 CCTTCCGAAGTTCAGCAATC Chr7:134665032..134665051 59.81 50
downstream ENSMUSE00000588014 Chr7:134664990..134665175 CCTTCCGAAGTTCAGCAATC Chr7:134665032..134665051 59.81 50
downstream ENSMUSE00000434591 Chr7:134665081..134665175 GTTCCTGAGCAAAGTCAGCA Chr7:134665149..134665168 59.17 50
downstream ENSMUSE00000632343 Chr7:134665503..134665518 No primer for this exon
downstream ENSMUSE00000632355 Chr7:134665503..134665643 CTCCTTTTGTCGCTGCTCTT Chr7:134665553..134665572 59.76 50
downstream ENSMUSE00000632354 Chr7:134668807..134669029 ATGAAGTCCAGGTGCAGGTC Chr7:134668883..134668902 60.12 55
downstream ENSMUSE00000632353 Chr7:134669145..134669419 ATTTTCTTCAGGCCCATCCT Chr7:134669392..134669411 59.9 45
downstream ENSMUSE00000632352 Chr7:134671910..134672003 ACATTGTGTGACAGCGGAAG Chr7:134671945..134671964 59.75 50
downstream ENSMUSE00000588009 Chr7:134672649..134672738 CTCCCCTTCCAACTGCTCTT Chr7:134672701..134672720 60.76 55
downstream ENSMUSE00000588023 Chr7:134672652..134672738 CCCTTCCAACTGCTCTTCAG Chr7:134672698..134672717 59.98 55
downstream ENSMUSE00000632351 Chr7:134673697..134673873 CAGAGGCATCACAGGCATAG Chr7:134673762..134673781 59.42 55
downstream ENSMUSE00000588007 Chr7:134673954..134674091 CTGAGCATCCTCCGACTCAT Chr7:134674066..134674085 60.37 55
downstream ENSMUSE00000588021 Chr7:134673954..134674312 CTGAGCATCCTCCGACTCAT Chr7:134674066..134674085 60.37 55
downstream ENSMUSE00000588006 Chr7:134674128..134674312 CTTGGGCTGGAGACTTTCAG Chr7:134674291..134674310 59.98 55
downstream ENSMUSE00000632350 Chr7:134674408..134674585 AAGCAAGGAGATGGTCTGGA Chr7:134674566..134674585 59.8 50
downstream ENSMUSE00000632349 Chr7:134674849..134674985 TTTAAAACTCGGGCACCAAC Chr7:134674940..134674959 59.97 45
downstream ENSMUSE00000632348 Chr7:134675234..134675403 AAAGCCTGGTGATCTTGCAG Chr7:134675310..134675329 60.4 50
downstream ENSMUSE00000632347 Chr7:134675541..134675733 TGGAGGCGTTTGACTAGACC Chr7:134675732..134675751 60.26 55
downstream ENSMUSE00000632346 Chr7:134678062..134678198 GGGCATCTGCTTCTCAACAT Chr7:134678121..134678140 60.23 50
downstream ENSMUSE00000588000 Chr7:134678289..134678475 GGTAACAGGTCGAGGGTCAA Chr7:134678400..134678419 59.97 55
downstream ENSMUSE00000632345 Chr7:134678289..134678493 GGTAACAGGTCGAGGGTCAA Chr7:134678400..134678419 59.97 55
downstream ENSMUSE00000587999 Chr7:134681515..134681684 AGATCAAACCGACCCATGTC Chr7:134681543..134681562 59.79 50
downstream ENSMUSE00000587998 Chr7:134682017..134682282 CACCACTGTACGGCCTTCTT Chr7:134682062..134682081 60.17 55
downstream ENSMUSE00000587997 Chr7:134683271..134683435 GTCAGTTTGTTGCCCTGGAT Chr7:134683382..134683401 59.97 50
downstream ENSMUSE00000587996 Chr7:134684170..134684436 GGCTAGGGGTTAACGTAGGG Chr7:134684334..134684353 59.85 60
downstream ENSMUSE00000587995 Chr7:134684756..134686221 CTGGGGTTGACACCAGAGTT Chr7:134685565..134685584 60 55
downstream ENSMUSE00000587994 Chr7:134692654..134692919 GTTGGGGCAAGGTACAGAAA Chr7:134692789..134692808 59.97 50
downstream ENSMUSE00000587993 Chr7:134693047..134693249 CACAGGAGGCATGACAAAGAT Chr7:134693073..134693093 60.13 47.62
downstream ENSMUSE00000587992 Chr7:134695773..134695942 AGATGGCCATGGTAGGTGAG Chr7:134695902..134695921 59.95 55
downstream ENSMUSE00000587991 Chr7:134696082..134696278 CCCACTTCGAGTTGAAAGGA Chr7:134696150..134696169 60.22 50
downstream ENSMUSE00000587990 Chr7:134696376..134696490 GAAGTTGCCTCCTTCAATGG Chr7:134696472..134696491 59.67 50
downstream ENSMUSE00000587989 Chr7:134696689..134696808 GCTCCTCCAGAGGCATATCA Chr7:134696731..134696750 60.33 55
downstream ENSMUSE00000587988 Chr7:134700922..134701122 CTTCATCTTCTGCCCGACAT Chr7:134700949..134700968 60.22 50
downstream ENSMUSE00000587987 Chr7:134701280..134701363 TTCTGCCTGTTTGAGCTCCT Chr7:134701366..134701385 60.13 50
downstream ENSMUSE00000527011 Chr7:134701482..134701821 AGTCGGAACACCTCCTCCTT Chr7:134701543..134701562 60.11 55
downstream ENSMUSE00000587986 Chr7:134701963..134704280 CTTCTTGGACTGGCGCTAAC Chr7:134702974..134702993 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTTTGAAAGTGGGGAAGG Chr7:134659715..134659735 60.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCAGCTCCCAATCCTACA Chr7:134659690..134659710 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053877