Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14765
Trapped Gene
Has3 (ENSMUSG00000031910)
Vector Insertion
Chr 8: 109394315 - 109397807
Public Clones PST15517-NR (escells) IST14591A2 (tigm) IST14899G3 (tigm) IST10545E11 (tigm)
IST14856F3 (tigm) IST12400B5 (tigm) IST12250C7 (tigm) IST15042D10 (tigm)
IST12400B5 (tigm) IST14568E12 (tigm) IST14591A2 (tigm) IST13509H7 (tigm)
IST11867H1 (tigm) IST14919E9 (tigm) IST14985B9 (tigm) IST10737G5 (tigm)
IST11773E12 (tigm) IST15074A1 (tigm) IST14856F3 (tigm) IST14197H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679730 (Chr8:109394142..109394314 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTGGCGTTCAGAAGATTT Chr8:109394273..109394292 59.31 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679730 (Chr8:109394142..109394314 +)
Downstram Exon
ENSMUSE00000214618 (Chr8:109397808..109398446 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTGGCGTTCAGAAGATTT Chr8:109394273..109394292 59.31 45 TGCTACGCCACACAAAGAAG Chr8:109398273..109398292 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679730 Chr8:109394142..109394314 CCTTGGCGTTCAGAAGATTT Chr8:109394273..109394292 59.31 45

*** Putative Vector Insertion (Chr 8: 109394315 - 109397807) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214618 Chr8:109397808..109398446 TGCTACGCCACACAAAGAAG Chr8:109398273..109398292 60.05 50
downstream ENSMUSE00000214617 Chr8:109400792..109400893 CCAAGACTCGAAGCATCTCA Chr8:109400855..109400874 59.11 50
downstream ENSMUSE00000634552 Chr8:109401805..109406802 GAGAATGCACTGCTGGTGAA Chr8:109406042..109406061 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTCACGTGTTTGCTCCTG Chr8:109394330..109394350 59.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTATGAGGTCGTGACTGG Chr8:109394355..109394375 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031910