Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14768
Trapped Gene
Rps29 (ENSMUSG00000034892)
Vector Insertion
Chr 12: 70259647 - 70260077
Public Clones CMHD-GT_531G9-3 (cmhd) PST15504-NR (escells) IST15004F12 (tigm)
Private Clones OST29980 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000654557 (Chr12:70259984..70260076 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGGTCACCAGCAGCTCTA Chr12:70260026..70260045 60.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000654557 (Chr12:70259984..70260076 -)
Downstram Exon
ENSMUSE00000504967 (Chr12:70259648..70259747 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGGTCACCAGCAGCTCTA Chr12:70260026..70260045 60.82 55 GCACATGTTCAGCCCGTATT Chr12:70259671..70259690 60.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000654557 Chr12:70259984..70260076 ATGGGTCACCAGCAGCTCTA Chr12:70260026..70260045 60.82 55
upstream ENSMUSE00000504967 Chr12:70259648..70259747 AGTACGCGAAGGACATAGGC Chr12:70259657..70259676 59.36 55

*** Putative Vector Insertion (Chr 12: 70259647 - 70260077) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000684647 Chr12:70258711..70258808 CATGATCGGTTCCACTTGGT Chr12:70258729..70258748 60.78 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAAGGCAAGATGGGTCAC Chr12:70260035..70260055 60.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCGACTCGTTCCTTTCTC Chr12:70260067..70260087 60.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr12:70259913..70259933 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTTAGAGGGAAGGGCCATTGT Chr12:70259935..70259956 61.56 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034892